Incidental Mutation 'R4599:Dpp6'
ID 345427
Institutional Source Beutler Lab
Gene Symbol Dpp6
Ensembl Gene ENSMUSG00000061576
Gene Name dipeptidylpeptidase 6
Synonyms Rw, In(5)6H-p, B930011P16Rik, Dpp-6, LOC384168, Peplb
MMRRC Submission 041815-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.085) question?
Stock # R4599 (G1)
Quality Score 225
Status Not validated
Chromosome 5
Chromosomal Location 27022355-27932498 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to T at 27839546 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glycine to Cysteine at position 354 (G354C)
Ref Sequence ENSEMBL: ENSMUSP00000113441 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071500] [ENSMUST00000101471] [ENSMUST00000120555] [ENSMUST00000122171]
AlphaFold Q9Z218
Predicted Effect probably damaging
Transcript: ENSMUST00000071500
AA Change: G299C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000071435
Gene: ENSMUSG00000061576
AA Change: G299C

DomainStartEndE-ValueType
transmembrane domain 35 57 N/A INTRINSIC
Pfam:DPPIV_N 134 500 7.2e-114 PFAM
Pfam:PD40 365 402 1.1e-5 PFAM
Pfam:Peptidase_S9 579 789 2.9e-39 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000101471
AA Change: G298C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000099012
Gene: ENSMUSG00000061576
AA Change: G298C

DomainStartEndE-ValueType
transmembrane domain 34 56 N/A INTRINSIC
Pfam:DPPIV_N 133 499 2.6e-114 PFAM
Pfam:PD40 364 401 9.3e-6 PFAM
Pfam:Peptidase_S9 578 788 1.9e-39 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000120555
AA Change: G296C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000113849
Gene: ENSMUSG00000061576
AA Change: G296C

DomainStartEndE-ValueType
transmembrane domain 32 54 N/A INTRINSIC
Pfam:DPPIV_N 131 497 2.6e-114 PFAM
Pfam:PD40 362 399 9.2e-6 PFAM
Pfam:Peptidase_S9 576 786 1.9e-39 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000122171
AA Change: G354C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000113441
Gene: ENSMUSG00000061576
AA Change: G354C

DomainStartEndE-ValueType
low complexity region 50 62 N/A INTRINSIC
transmembrane domain 90 112 N/A INTRINSIC
Pfam:DPPIV_N 189 555 6.4e-113 PFAM
Pfam:PD40 425 457 1.1e-4 PFAM
Pfam:Peptidase_S9 634 844 4.3e-40 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134175
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a single-pass type II membrane protein that is a member of the peptidase S9B family of serine proteases. This protein has no detectable protease activity, most likely due to the absence of the conserved serine residue normally present in the catalytic domain of serine proteases. However, it does bind specific voltage-gated potassium channels and alters their expression and biophysical properties. Variations in this gene may be associated with susceptibility to amyotrophic lateral sclerosis and with idiopathic ventricular fibrillation. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2014]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit loss of A-type K+ current gradients in distal dendrites. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca14 T C 7: 119,854,626 (GRCm39) V930A probably benign Het
Ankrd13b T C 11: 77,362,494 (GRCm39) R677G probably benign Het
Apc T A 18: 34,451,040 (GRCm39) Y2611* probably null Het
Apold1 A G 6: 134,961,032 (GRCm39) Y162C probably damaging Het
Atp6v0a4 T C 6: 38,055,737 (GRCm39) I325V probably benign Het
Cab39 A G 1: 85,776,050 (GRCm39) Y249C probably damaging Het
Cd22 T A 7: 30,575,325 (GRCm39) H239L probably damaging Het
Chrna7 A G 7: 62,753,538 (GRCm39) M327T probably damaging Het
Cimip2b T C 4: 43,427,574 (GRCm39) H250R possibly damaging Het
Clock T C 5: 76,383,657 (GRCm39) M499V probably benign Het
Clspn A G 4: 126,475,253 (GRCm39) E1002G probably benign Het
Clta C T 4: 44,012,819 (GRCm39) P10S probably damaging Het
Col5a3 A G 9: 20,685,855 (GRCm39) probably null Het
Coq6 T C 12: 84,408,913 (GRCm39) V30A probably benign Het
Csmd2 G T 4: 127,881,921 (GRCm39) R20L probably benign Het
D430041D05Rik A T 2: 104,038,528 (GRCm39) V1547D probably damaging Het
Dapk1 C T 13: 60,865,861 (GRCm39) P153S probably benign Het
Dock2 T A 11: 34,189,536 (GRCm39) Y1545F probably damaging Het
Dyrk1b T C 7: 27,881,856 (GRCm39) L105P probably damaging Het
Epor A G 9: 21,873,155 (GRCm39) S86P probably benign Het
Gale C A 4: 135,695,148 (GRCm39) S341* probably null Het
Galnt4 T A 10: 98,945,355 (GRCm39) V360E probably damaging Het
Gart A T 16: 91,419,833 (GRCm39) C24* probably null Het
Gcnt2 G T 13: 41,040,966 (GRCm39) V42L probably benign Het
Herc6 A G 6: 57,636,698 (GRCm39) I805V probably benign Het
Ints12 T A 3: 132,804,214 (GRCm39) I67N probably benign Het
Irx1 C A 13: 72,108,232 (GRCm39) R150L probably damaging Het
Kif26b A G 1: 178,358,024 (GRCm39) Y45C unknown Het
Krt35 T C 11: 99,984,834 (GRCm39) T275A probably damaging Het
Laptm5 G T 4: 130,643,316 (GRCm39) probably benign Het
Lin7a T C 10: 107,248,027 (GRCm39) S111P unknown Het
Med27 A G 2: 29,414,470 (GRCm39) D159G probably damaging Het
Msh2 A G 17: 88,016,006 (GRCm39) K546R probably damaging Het
Myo1a A T 10: 127,556,020 (GRCm39) probably null Het
Myo1c T C 11: 75,559,019 (GRCm39) F604L probably damaging Het
Myrip A G 9: 120,293,850 (GRCm39) K782E probably damaging Het
Ndc80 T C 17: 71,828,063 (GRCm39) D88G probably damaging Het
Nrxn2 A G 19: 6,505,282 (GRCm39) D375G probably damaging Het
Or2y10 T C 11: 49,455,545 (GRCm39) S266P probably damaging Het
Or52e7 A G 7: 104,685,280 (GRCm39) I292V probably benign Het
Padi3 T C 4: 140,525,422 (GRCm39) H187R probably damaging Het
Pcdhgb1 A T 18: 37,814,610 (GRCm39) N367I probably damaging Het
Pdrg1 T C 2: 152,854,310 (GRCm39) I77V probably benign Het
Pfas T C 11: 68,881,895 (GRCm39) E930G probably benign Het
Pik3cb C T 9: 98,943,817 (GRCm39) R662Q probably benign Het
Pla2g4e T G 2: 120,016,863 (GRCm39) H226P possibly damaging Het
Plxnd1 A T 6: 115,971,237 (GRCm39) V177E probably damaging Het
Prmt7 A G 8: 106,976,961 (GRCm39) S558G possibly damaging Het
Pspc1 A C 14: 57,015,246 (GRCm39) probably null Het
Rilp T C 11: 75,403,586 (GRCm39) S343P probably benign Het
Ror1 A G 4: 100,265,107 (GRCm39) M194V probably damaging Het
Rsu1 T C 2: 13,174,815 (GRCm39) Y225C probably damaging Het
Rundc1 A G 11: 101,324,752 (GRCm39) N486S probably damaging Het
Sema6d T A 2: 124,496,151 (GRCm39) I65N probably damaging Het
Slc5a11 A G 7: 122,857,601 (GRCm39) E230G probably benign Het
Spint1 T C 2: 119,076,941 (GRCm39) S342P probably damaging Het
Stard3nl A G 13: 19,551,923 (GRCm39) S214P probably damaging Het
Tcp10a A C 17: 7,604,323 (GRCm39) T271P probably damaging Het
Tie1 A G 4: 118,329,831 (GRCm39) Y1091H probably benign Het
Tlr12 T C 4: 128,511,125 (GRCm39) Y375C probably benign Het
Tmem107 T A 11: 68,962,274 (GRCm39) M77K probably damaging Het
Tns2 C T 15: 102,017,369 (GRCm39) R281C probably damaging Het
Tns3 T C 11: 8,481,747 (GRCm39) K202E probably damaging Het
Tspoap1 C T 11: 87,670,347 (GRCm39) P1634L probably damaging Het
Ttc7b G A 12: 100,466,376 (GRCm39) R79C probably damaging Het
Ush2a A G 1: 188,643,844 (GRCm39) N4402S probably benign Het
Vmn2r13 A T 5: 109,304,322 (GRCm39) I703N probably damaging Het
Xrcc4 A G 13: 90,210,126 (GRCm39) probably null Het
Zp3 A T 5: 136,013,089 (GRCm39) K168* probably null Het
Other mutations in Dpp6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00310:Dpp6 APN 5 27,928,441 (GRCm39) missense probably damaging 1.00
IGL01137:Dpp6 APN 5 27,919,486 (GRCm39) missense probably damaging 1.00
IGL01386:Dpp6 APN 5 27,869,760 (GRCm39) critical splice donor site probably null
IGL01409:Dpp6 APN 5 27,762,599 (GRCm39) missense probably damaging 1.00
IGL01721:Dpp6 APN 5 27,836,518 (GRCm39) missense probably damaging 1.00
IGL02149:Dpp6 APN 5 27,743,022 (GRCm39) missense probably benign 0.00
IGL02174:Dpp6 APN 5 27,926,085 (GRCm39) nonsense probably null
IGL02176:Dpp6 APN 5 27,928,575 (GRCm39) missense probably damaging 0.98
IGL02326:Dpp6 APN 5 27,869,755 (GRCm39) missense probably damaging 1.00
IGL02336:Dpp6 APN 5 27,674,409 (GRCm39) missense probably benign 0.04
IGL02339:Dpp6 APN 5 27,857,228 (GRCm39) missense probably damaging 0.97
IGL02402:Dpp6 APN 5 27,839,541 (GRCm39) missense probably damaging 1.00
IGL02884:Dpp6 APN 5 27,839,554 (GRCm39) missense possibly damaging 0.88
IGL02885:Dpp6 APN 5 27,923,471 (GRCm39) missense probably damaging 1.00
IGL02938:Dpp6 APN 5 27,928,365 (GRCm39) splice site probably benign
IGL03083:Dpp6 APN 5 27,914,548 (GRCm39) critical splice donor site probably null
I0000:Dpp6 UTSW 5 27,603,920 (GRCm39) missense probably benign 0.02
IGL03052:Dpp6 UTSW 5 27,914,506 (GRCm39) missense probably benign 0.03
PIT4431001:Dpp6 UTSW 5 27,836,496 (GRCm39) missense probably benign 0.03
R0060:Dpp6 UTSW 5 27,803,817 (GRCm39) missense probably damaging 1.00
R0360:Dpp6 UTSW 5 27,857,267 (GRCm39) missense probably damaging 1.00
R0486:Dpp6 UTSW 5 27,866,640 (GRCm39) missense probably benign 0.39
R0501:Dpp6 UTSW 5 27,930,604 (GRCm39) missense probably damaging 1.00
R1028:Dpp6 UTSW 5 27,871,425 (GRCm39) missense probably benign 0.01
R1164:Dpp6 UTSW 5 27,926,103 (GRCm39) missense probably benign 0.02
R1177:Dpp6 UTSW 5 27,868,471 (GRCm39) missense possibly damaging 0.94
R1993:Dpp6 UTSW 5 27,604,004 (GRCm39) missense probably benign 0.00
R2024:Dpp6 UTSW 5 27,914,457 (GRCm39) missense possibly damaging 0.67
R2100:Dpp6 UTSW 5 27,869,742 (GRCm39) missense probably damaging 0.96
R2329:Dpp6 UTSW 5 27,656,286 (GRCm39) splice site probably null
R3619:Dpp6 UTSW 5 27,926,118 (GRCm39) missense possibly damaging 0.74
R3871:Dpp6 UTSW 5 27,674,463 (GRCm39) missense probably benign 0.03
R3872:Dpp6 UTSW 5 27,926,056 (GRCm39) missense probably damaging 1.00
R4114:Dpp6 UTSW 5 27,674,485 (GRCm39) critical splice donor site probably null
R4403:Dpp6 UTSW 5 27,923,460 (GRCm39) missense probably damaging 1.00
R4736:Dpp6 UTSW 5 27,917,657 (GRCm39) missense probably damaging 1.00
R4929:Dpp6 UTSW 5 27,254,785 (GRCm39) missense probably benign 0.25
R4967:Dpp6 UTSW 5 27,871,509 (GRCm39) missense probably damaging 1.00
R5162:Dpp6 UTSW 5 27,604,013 (GRCm39) unclassified probably benign
R5270:Dpp6 UTSW 5 27,839,532 (GRCm39) missense probably damaging 0.98
R5334:Dpp6 UTSW 5 27,914,538 (GRCm39) missense probably benign 0.30
R5437:Dpp6 UTSW 5 27,868,499 (GRCm39) nonsense probably null
R5663:Dpp6 UTSW 5 27,254,620 (GRCm39) missense possibly damaging 0.84
R6023:Dpp6 UTSW 5 27,928,545 (GRCm39) missense probably damaging 0.96
R6244:Dpp6 UTSW 5 27,254,626 (GRCm39) missense probably damaging 0.99
R6312:Dpp6 UTSW 5 27,930,669 (GRCm39) missense possibly damaging 0.84
R6442:Dpp6 UTSW 5 27,923,507 (GRCm39) critical splice donor site probably null
R6942:Dpp6 UTSW 5 27,674,457 (GRCm39) missense possibly damaging 0.79
R6956:Dpp6 UTSW 5 27,803,819 (GRCm39) missense probably damaging 1.00
R7210:Dpp6 UTSW 5 27,803,801 (GRCm39) missense probably damaging 0.99
R7342:Dpp6 UTSW 5 27,919,552 (GRCm39) missense probably benign
R7702:Dpp6 UTSW 5 27,857,274 (GRCm39) missense probably benign 0.00
R7727:Dpp6 UTSW 5 27,656,242 (GRCm39) missense probably benign 0.30
R7899:Dpp6 UTSW 5 27,926,077 (GRCm39) missense probably benign 0.03
R7966:Dpp6 UTSW 5 27,928,370 (GRCm39) missense probably benign 0.06
R8015:Dpp6 UTSW 5 27,022,808 (GRCm39) start gained probably benign
R8084:Dpp6 UTSW 5 27,836,397 (GRCm39) missense probably benign 0.32
R8178:Dpp6 UTSW 5 27,803,815 (GRCm39) missense probably damaging 1.00
R8384:Dpp6 UTSW 5 27,923,472 (GRCm39) missense probably benign 0.18
R8816:Dpp6 UTSW 5 27,930,711 (GRCm39) missense probably benign 0.07
R8936:Dpp6 UTSW 5 27,926,140 (GRCm39) missense probably damaging 1.00
R9090:Dpp6 UTSW 5 27,803,832 (GRCm39) nonsense probably null
R9164:Dpp6 UTSW 5 27,656,286 (GRCm39) splice site probably null
R9271:Dpp6 UTSW 5 27,803,832 (GRCm39) nonsense probably null
R9310:Dpp6 UTSW 5 27,930,642 (GRCm39) missense probably benign 0.11
R9310:Dpp6 UTSW 5 27,836,439 (GRCm39) missense probably damaging 0.97
R9320:Dpp6 UTSW 5 27,868,521 (GRCm39) critical splice donor site probably null
R9667:Dpp6 UTSW 5 27,930,604 (GRCm39) missense probably damaging 1.00
R9761:Dpp6 UTSW 5 27,869,743 (GRCm39) missense probably benign 0.38
Z1176:Dpp6 UTSW 5 27,603,996 (GRCm39) missense probably damaging 1.00
Z1177:Dpp6 UTSW 5 27,917,640 (GRCm39) missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- AGCCCAAAGATCTCCTTGCC -3'
(R):5'- AAAGTATATGCTGCCTGGTGTTTTC -3'

Sequencing Primer
(F):5'- AAGCCAGCTTTGGTGAACTC -3'
(R):5'- TTTTTCCCCCAGGTAAATAAACCAC -3'
Posted On 2015-09-25