Mutagenetix > Incidental Mutation

Incidental Mutation 'R4599:Clock'

345428

Institutional Source

Beutler Lab

Gene Symbol

Clock

Ensembl Gene

ENSMUSG00000029238

Gene Name

circadian locomotor output cycles kaput

Synonyms

5330400M04Rik, bHLHe8, KAT13D

MMRRC Submission

041815-MU

Accession Numbers

Essential gene?

Possibly essential (E-score: 0.631) question?

Stock #

R4599 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

76209868-76304792 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 76235810 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Methionine to Valine at position 499 (M499V)

Ref Sequence

ENSEMBL: ENSMUSP00000143939 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000075159] [ENSMUST00000202122] [ENSMUST00000202651]

AlphaFold

O08785

Predicted Effect

probably benign
Transcript: ENSMUST00000075159
AA Change: M499V

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)

SMART Domains

Protein: ENSMUSP00000074656
Gene: ENSMUSG00000029238
AA Change: M499V

Domain	Start	End	E-Value	Type
HLH	40	90	7.77e-12	SMART
PAS	109	175	1.88e-6	SMART
PAS	264	330	3.65e-4	SMART
PAC	336	379	7.63e-7	SMART
low complexity region	426	446	N/A	INTRINSIC
low complexity region	478	493	N/A	INTRINSIC
coiled coil region	523	559	N/A	INTRINSIC
low complexity region	619	634	N/A	INTRINSIC
low complexity region	640	657	N/A	INTRINSIC
low complexity region	738	796	N/A	INTRINSIC
low complexity region	818	837	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000201768

Predicted Effect

probably benign
Transcript: ENSMUST00000202122
AA Change: M499V

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)

SMART Domains

Protein: ENSMUSP00000144022
Gene: ENSMUSG00000029238
AA Change: M499V

Domain	Start	End	E-Value	Type
TFS2N	34	106	4.1e-3	SMART
HLH	40	90	3.4e-14	SMART
PAS	109	175	9.6e-9	SMART
PAS	264	330	1.8e-6	SMART
PAC	336	379	3.9e-9	SMART
low complexity region	426	446	N/A	INTRINSIC
low complexity region	478	493	N/A	INTRINSIC
coiled coil region	523	559	N/A	INTRINSIC
low complexity region	619	633	N/A	INTRINSIC
low complexity region	639	656	N/A	INTRINSIC
low complexity region	737	795	N/A	INTRINSIC
low complexity region	817	836	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000202651
AA Change: M499V

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)

SMART Domains

Protein: ENSMUSP00000143939
Gene: ENSMUSG00000029238
AA Change: M499V

Domain	Start	End	E-Value	Type
HLH	40	90	7.77e-12	SMART
PAS	109	175	1.88e-6	SMART
PAS	264	330	3.65e-4	SMART
PAC	336	379	7.63e-7	SMART
low complexity region	426	446	N/A	INTRINSIC
low complexity region	478	493	N/A	INTRINSIC
coiled coil region	523	559	N/A	INTRINSIC
low complexity region	619	634	N/A	INTRINSIC
low complexity region	640	657	N/A	INTRINSIC
low complexity region	738	796	N/A	INTRINSIC
low complexity region	818	837	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000202857

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.4%
20x: 95.4%

Validation Efficiency

MGI Phenotype

FUNCTION: The protein encoded by this gene plays a central role in the regulation of circadian rhythms. The protein encodes a transcription factor of the basic helix-loop-helix (bHLH) family and contains DNA binding histone acetyltransferase activity. The encoded protein forms a heterodimer with Arntl (Bmal1) that binds E-box enhancer elements upstream of Period (Per1, Per2, Per3) and Cryptochrome (Cry1, Cry2) genes and activates transcription of these genes. Per and Cry proteins heterodimerize and repress their own transcription by interacting in a feedback loop with Clock/Arntl complexes. Polymorphisms in this gene may be associated with behavioral changes, obesity, and metabolic syndrome. Two transcripts encoding the same protein have been found for this gene. [provided by RefSeq, Jan 2014]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit abnormal circadian phase. Mice homozygous for a spontaneous mutation exhibit abnormal circadian rhythm, reproduction, behavior, hair cycle, macronutrient absorption, and metabolism. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 69 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca14	T	C	7: 120,255,403	V930A	probably benign	Het
Ankrd13b	T	C	11: 77,471,668	R677G	probably benign	Het
Apc	T	A	18: 34,317,987	Y2611*	probably null	Het
Apold1	A	G	6: 134,984,069	Y162C	probably damaging	Het
Atp6v0a4	T	C	6: 38,078,802	I325V	probably benign	Het
Cab39	A	G	1: 85,848,329	Y249C	probably damaging	Het
Cd22	T	A	7: 30,875,900	H239L	probably damaging	Het
Chrna7	A	G	7: 63,103,790	M327T	probably damaging	Het
Clspn	A	G	4: 126,581,460	E1002G	probably benign	Het
Clta	C	T	4: 44,012,819	P10S	probably damaging	Het
Col5a3	A	G	9: 20,774,559		probably null	Het
Coq6	T	C	12: 84,362,139	V30A	probably benign	Het
Csmd2	G	T	4: 127,988,128	R20L	probably benign	Het
D430041D05Rik	A	T	2: 104,208,183	V1547D	probably damaging	Het
Dapk1	C	T	13: 60,718,047	P153S	probably benign	Het
Dock2	T	A	11: 34,239,536	Y1545F	probably damaging	Het
Dpp6	G	T	5: 27,634,548	G354C	probably damaging	Het
Dyrk1b	T	C	7: 28,182,431	L105P	probably damaging	Het
Epor	A	G	9: 21,961,859	S86P	probably benign	Het
Fam166b	T	C	4: 43,427,574	H250R	possibly damaging	Het
Gale	C	A	4: 135,967,837	S341*	probably null	Het
Galnt4	T	A	10: 99,109,493	V360E	probably damaging	Het
Gart	A	T	16: 91,622,945	C24*	probably null	Het
Gcnt2	G	T	13: 40,887,490	V42L	probably benign	Het
Herc6	A	G	6: 57,659,713	I805V	probably benign	Het
Ints12	T	A	3: 133,098,453	I67N	probably benign	Het
Irx1	C	A	13: 71,960,113	R150L	probably damaging	Het
Kif26b	A	G	1: 178,530,459	Y45C	unknown	Het
Krt35	T	C	11: 100,094,008	T275A	probably damaging	Het
Laptm5	G	T	4: 130,916,005		probably benign	Het
Lin7a	T	C	10: 107,412,166	S111P	unknown	Het
Med27	A	G	2: 29,524,458	D159G	probably damaging	Het
Msh2	A	G	17: 87,708,578	K546R	probably damaging	Het
Myo1a	A	T	10: 127,720,151		probably null	Het
Myo1c	T	C	11: 75,668,193	F604L	probably damaging	Het
Myrip	A	G	9: 120,464,784	K782E	probably damaging	Het
Ndc80	T	C	17: 71,521,068	D88G	probably damaging	Het
Nrxn2	A	G	19: 6,455,252	D375G	probably damaging	Het
Olfr1380	T	C	11: 49,564,718	S266P	probably damaging	Het
Olfr676	A	G	7: 105,036,073	I292V	probably benign	Het
Padi3	T	C	4: 140,798,111	H187R	probably damaging	Het
Pcdhgb1	A	T	18: 37,681,557	N367I	probably damaging	Het
Pdrg1	T	C	2: 153,012,390	I77V	probably benign	Het
Pfas	T	C	11: 68,991,069	E930G	probably benign	Het
Pik3cb	C	T	9: 99,061,764	R662Q	probably benign	Het
Pla2g4e	T	G	2: 120,186,382	H226P	possibly damaging	Het
Plxnd1	A	T	6: 115,994,276	V177E	probably damaging	Het
Prmt7	A	G	8: 106,250,329	S558G	possibly damaging	Het
Pspc1	A	C	14: 56,777,789		probably null	Het
Rilp	T	C	11: 75,512,760	S343P	probably benign	Het
Ror1	A	G	4: 100,407,910	M194V	probably damaging	Het
Rsu1	T	C	2: 13,170,004	Y225C	probably damaging	Het
Rundc1	A	G	11: 101,433,926	N486S	probably damaging	Het
Sema6d	T	A	2: 124,654,231	I65N	probably damaging	Het
Slc5a11	A	G	7: 123,258,378	E230G	probably benign	Het
Spint1	T	C	2: 119,246,460	S342P	probably damaging	Het
Stard3nl	A	G	13: 19,367,753	S214P	probably damaging	Het
Tcp10a	A	C	17: 7,336,924	T271P	probably damaging	Het
Tie1	A	G	4: 118,472,634	Y1091H	probably benign	Het
Tlr12	T	C	4: 128,617,332	Y375C	probably benign	Het
Tmem107	T	A	11: 69,071,448	M77K	probably damaging	Het
Tns2	C	T	15: 102,108,934	R281C	probably damaging	Het
Tns3	T	C	11: 8,531,747	K202E	probably damaging	Het
Tspoap1	C	T	11: 87,779,521	P1634L	probably damaging	Het
Ttc7b	G	A	12: 100,500,117	R79C	probably damaging	Het
Ush2a	A	G	1: 188,911,647	N4402S	probably benign	Het
Vmn2r13	A	T	5: 109,156,456	I703N	probably damaging	Het
Xrcc4	A	G	13: 90,062,007		probably null	Het
Zp3	A	T	5: 135,984,235	K168*	probably null	Het

Other mutations in Clock

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00598:Clock	APN	5	76229464	missense	probably benign	0.17
IGL00725:Clock	APN	5	76254413	nonsense	probably null
IGL01304:Clock	APN	5	76266355	critical splice donor site	probably null
IGL01369:Clock	APN	5	76237086	missense	probably benign	0.30
IGL01542:Clock	APN	5	76231475	missense	possibly damaging	0.82
IGL02541:Clock	APN	5	76262672	splice site	probably null
IGL02602:Clock	APN	5	76254426	missense	probably null	1.00
IGL02602:Clock	APN	5	76254427	missense	probably damaging	1.00
IGL03186:Clock	APN	5	76243082	missense	probably damaging	0.98
IGL03309:Clock	APN	5	76231394	critical splice donor site	probably null
R6760_Clock_188	UTSW	5	76226976	missense	unknown
uhr	UTSW	5	76229554	nonsense	probably null
R0304:Clock	UTSW	5	76226985	missense	unknown
R0593:Clock	UTSW	5	76265836	missense	probably benign	0.25
R0654:Clock	UTSW	5	76227129	missense	possibly damaging	0.95
R0684:Clock	UTSW	5	76245518	missense	probably damaging	0.96
R0707:Clock	UTSW	5	76227129	missense	possibly damaging	0.95
R0751:Clock	UTSW	5	76229361	missense	possibly damaging	0.75
R0865:Clock	UTSW	5	76266424	splice site	probably benign
R0920:Clock	UTSW	5	76230320	missense	possibly damaging	0.80
R1396:Clock	UTSW	5	76266802	missense	probably benign	0.00
R1450:Clock	UTSW	5	76262731	nonsense	probably null
R1487:Clock	UTSW	5	76266354	splice site	probably null
R1574:Clock	UTSW	5	76242832	missense	probably damaging	1.00
R1574:Clock	UTSW	5	76242832	missense	probably damaging	1.00
R1858:Clock	UTSW	5	76240909	missense	possibly damaging	0.92
R1872:Clock	UTSW	5	76248462	missense	possibly damaging	0.67
R1905:Clock	UTSW	5	76266888	splice site	probably benign
R1937:Clock	UTSW	5	76229493	missense	probably damaging	0.99
R2411:Clock	UTSW	5	76231513	missense	probably benign	0.08
R2887:Clock	UTSW	5	76245273	missense	probably damaging	0.99
R3410:Clock	UTSW	5	76229554	nonsense	probably null
R4514:Clock	UTSW	5	76230199	missense	probably benign	0.00
R4598:Clock	UTSW	5	76235810	missense	probably benign	0.00
R4795:Clock	UTSW	5	76265916	missense	probably damaging	1.00
R4796:Clock	UTSW	5	76265916	missense	probably damaging	1.00
R4973:Clock	UTSW	5	76254411	missense	possibly damaging	0.62
R5204:Clock	UTSW	5	76243170	splice site	probably null
R5271:Clock	UTSW	5	76241954	missense	probably damaging	1.00
R5547:Clock	UTSW	5	76230338	missense	probably benign	0.02
R5630:Clock	UTSW	5	76230338	missense	probably benign	0.02
R5631:Clock	UTSW	5	76230338	missense	probably benign	0.02
R5632:Clock	UTSW	5	76230338	missense	probably benign	0.02
R5787:Clock	UTSW	5	76237051	missense	probably damaging	1.00
R6274:Clock	UTSW	5	76237153	missense	probably benign	0.45
R6578:Clock	UTSW	5	76216709	missense	unknown
R6622:Clock	UTSW	5	76241954	missense	probably damaging	1.00
R6760:Clock	UTSW	5	76226976	missense	unknown
R6793:Clock	UTSW	5	76237120	frame shift	probably null
R7406:Clock	UTSW	5	76266845	start codon destroyed	probably null	0.26
R7414:Clock	UTSW	5	76262764	missense	probably benign	0.00
R7560:Clock	UTSW	5	76242891	splice site	probably null
R7593:Clock	UTSW	5	76236298	missense	possibly damaging	0.80
R7640:Clock	UTSW	5	76248378	missense	possibly damaging	0.71
R7708:Clock	UTSW	5	76266409	missense	probably benign	0.00
R7713:Clock	UTSW	5	76245420	critical splice donor site	probably null
R7807:Clock	UTSW	5	76243135	missense	probably benign	0.01
R8171:Clock	UTSW	5	76266414	missense	possibly damaging	0.94
R8190:Clock	UTSW	5	76227204	missense	probably damaging	0.98
R8225:Clock	UTSW	5	76241912	missense	probably damaging	0.99
R8309:Clock	UTSW	5	76254422	missense	probably benign	0.07
R8557:Clock	UTSW	5	76229370	missense	probably damaging	1.00
R8792:Clock	UTSW	5	76262727	missense	probably damaging	1.00
R8869:Clock	UTSW	5	76227042	small deletion	probably benign
R8870:Clock	UTSW	5	76235785	missense	probably benign	0.17
R8980:Clock	UTSW	5	76254439	missense	probably benign	0.01
R8982:Clock	UTSW	5	76216712	missense	unknown
R9177:Clock	UTSW	5	76229409	missense	probably benign	0.00
R9208:Clock	UTSW	5	76237024	missense	probably benign	0.00
R9213:Clock	UTSW	5	76245529	missense	possibly damaging	0.94
R9307:Clock	UTSW	5	76216824	missense	unknown
R9446:Clock	UTSW	5	76248441	missense	probably benign	0.00
R9516:Clock	UTSW	5	76229380	missense	possibly damaging	0.85
R9572:Clock	UTSW	5	76229491	missense	probably benign	0.00
R9630:Clock	UTSW	5	76245434	missense	probably benign	0.03

Predicted Primers

PCR Primer
(F):5'- GATTCTTTCTAGTAAGGGTCCACC -3'
(R):5'- GGCAGCTCACTTTGTACTCAAC -3'

Sequencing Primer
(F):5'- GTAAGGGTCCACCAAAATCATTG -3'
(R):5'- TCAACAAAGTGAGGTTGATTGTCAG -3'

Posted On

2015-09-25