Incidental Mutation 'R4599:Clock'
ID 345428
Institutional Source Beutler Lab
Gene Symbol Clock
Ensembl Gene ENSMUSG00000029238
Gene Name clock circadian regulator
Synonyms bHLHe8, KAT13D, 5330400M04Rik
MMRRC Submission 041815-MU
Accession Numbers
Essential gene? Possibly essential (E-score: 0.728) question?
Stock # R4599 (G1)
Quality Score 225
Status Not validated
Chromosome 5
Chromosomal Location 76357715-76452639 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 76383657 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Methionine to Valine at position 499 (M499V)
Ref Sequence ENSEMBL: ENSMUSP00000143939 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075159] [ENSMUST00000202122] [ENSMUST00000202651]
AlphaFold O08785
Predicted Effect probably benign
Transcript: ENSMUST00000075159
AA Change: M499V

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000074656
Gene: ENSMUSG00000029238
AA Change: M499V

DomainStartEndE-ValueType
HLH 40 90 7.77e-12 SMART
PAS 109 175 1.88e-6 SMART
PAS 264 330 3.65e-4 SMART
PAC 336 379 7.63e-7 SMART
low complexity region 426 446 N/A INTRINSIC
low complexity region 478 493 N/A INTRINSIC
coiled coil region 523 559 N/A INTRINSIC
low complexity region 619 634 N/A INTRINSIC
low complexity region 640 657 N/A INTRINSIC
low complexity region 738 796 N/A INTRINSIC
low complexity region 818 837 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000201768
Predicted Effect probably benign
Transcript: ENSMUST00000202122
AA Change: M499V

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000144022
Gene: ENSMUSG00000029238
AA Change: M499V

DomainStartEndE-ValueType
TFS2N 34 106 4.1e-3 SMART
HLH 40 90 3.4e-14 SMART
PAS 109 175 9.6e-9 SMART
PAS 264 330 1.8e-6 SMART
PAC 336 379 3.9e-9 SMART
low complexity region 426 446 N/A INTRINSIC
low complexity region 478 493 N/A INTRINSIC
coiled coil region 523 559 N/A INTRINSIC
low complexity region 619 633 N/A INTRINSIC
low complexity region 639 656 N/A INTRINSIC
low complexity region 737 795 N/A INTRINSIC
low complexity region 817 836 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000202651
AA Change: M499V

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000143939
Gene: ENSMUSG00000029238
AA Change: M499V

DomainStartEndE-ValueType
HLH 40 90 7.77e-12 SMART
PAS 109 175 1.88e-6 SMART
PAS 264 330 3.65e-4 SMART
PAC 336 379 7.63e-7 SMART
low complexity region 426 446 N/A INTRINSIC
low complexity region 478 493 N/A INTRINSIC
coiled coil region 523 559 N/A INTRINSIC
low complexity region 619 634 N/A INTRINSIC
low complexity region 640 657 N/A INTRINSIC
low complexity region 738 796 N/A INTRINSIC
low complexity region 818 837 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000202857
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: The protein encoded by this gene plays a central role in the regulation of circadian rhythms. The protein encodes a transcription factor of the basic helix-loop-helix (bHLH) family and contains DNA binding histone acetyltransferase activity. The encoded protein forms a heterodimer with Arntl (Bmal1) that binds E-box enhancer elements upstream of Period (Per1, Per2, Per3) and Cryptochrome (Cry1, Cry2) genes and activates transcription of these genes. Per and Cry proteins heterodimerize and repress their own transcription by interacting in a feedback loop with Clock/Arntl complexes. Polymorphisms in this gene may be associated with behavioral changes, obesity, and metabolic syndrome. Two transcripts encoding the same protein have been found for this gene. [provided by RefSeq, Jan 2014]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit abnormal circadian phase. Mice homozygous for a spontaneous mutation exhibit abnormal circadian rhythm, reproduction, behavior, hair cycle, macronutrient absorption, and metabolism. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca14 T C 7: 119,854,626 (GRCm39) V930A probably benign Het
Ankrd13b T C 11: 77,362,494 (GRCm39) R677G probably benign Het
Apc T A 18: 34,451,040 (GRCm39) Y2611* probably null Het
Apold1 A G 6: 134,961,032 (GRCm39) Y162C probably damaging Het
Atp6v0a4 T C 6: 38,055,737 (GRCm39) I325V probably benign Het
Cab39 A G 1: 85,776,050 (GRCm39) Y249C probably damaging Het
Cd22 T A 7: 30,575,325 (GRCm39) H239L probably damaging Het
Chrna7 A G 7: 62,753,538 (GRCm39) M327T probably damaging Het
Cimip2b T C 4: 43,427,574 (GRCm39) H250R possibly damaging Het
Clspn A G 4: 126,475,253 (GRCm39) E1002G probably benign Het
Clta C T 4: 44,012,819 (GRCm39) P10S probably damaging Het
Col5a3 A G 9: 20,685,855 (GRCm39) probably null Het
Coq6 T C 12: 84,408,913 (GRCm39) V30A probably benign Het
Csmd2 G T 4: 127,881,921 (GRCm39) R20L probably benign Het
D430041D05Rik A T 2: 104,038,528 (GRCm39) V1547D probably damaging Het
Dapk1 C T 13: 60,865,861 (GRCm39) P153S probably benign Het
Dock2 T A 11: 34,189,536 (GRCm39) Y1545F probably damaging Het
Dpp6 G T 5: 27,839,546 (GRCm39) G354C probably damaging Het
Dyrk1b T C 7: 27,881,856 (GRCm39) L105P probably damaging Het
Epor A G 9: 21,873,155 (GRCm39) S86P probably benign Het
Gale C A 4: 135,695,148 (GRCm39) S341* probably null Het
Galnt4 T A 10: 98,945,355 (GRCm39) V360E probably damaging Het
Gart A T 16: 91,419,833 (GRCm39) C24* probably null Het
Gcnt2 G T 13: 41,040,966 (GRCm39) V42L probably benign Het
Herc6 A G 6: 57,636,698 (GRCm39) I805V probably benign Het
Ints12 T A 3: 132,804,214 (GRCm39) I67N probably benign Het
Irx1 C A 13: 72,108,232 (GRCm39) R150L probably damaging Het
Kif26b A G 1: 178,358,024 (GRCm39) Y45C unknown Het
Krt35 T C 11: 99,984,834 (GRCm39) T275A probably damaging Het
Laptm5 G T 4: 130,643,316 (GRCm39) probably benign Het
Lin7a T C 10: 107,248,027 (GRCm39) S111P unknown Het
Med27 A G 2: 29,414,470 (GRCm39) D159G probably damaging Het
Msh2 A G 17: 88,016,006 (GRCm39) K546R probably damaging Het
Myo1a A T 10: 127,556,020 (GRCm39) probably null Het
Myo1c T C 11: 75,559,019 (GRCm39) F604L probably damaging Het
Myrip A G 9: 120,293,850 (GRCm39) K782E probably damaging Het
Ndc80 T C 17: 71,828,063 (GRCm39) D88G probably damaging Het
Nrxn2 A G 19: 6,505,282 (GRCm39) D375G probably damaging Het
Or2y10 T C 11: 49,455,545 (GRCm39) S266P probably damaging Het
Or52e7 A G 7: 104,685,280 (GRCm39) I292V probably benign Het
Padi3 T C 4: 140,525,422 (GRCm39) H187R probably damaging Het
Pcdhgb1 A T 18: 37,814,610 (GRCm39) N367I probably damaging Het
Pdrg1 T C 2: 152,854,310 (GRCm39) I77V probably benign Het
Pfas T C 11: 68,881,895 (GRCm39) E930G probably benign Het
Pik3cb C T 9: 98,943,817 (GRCm39) R662Q probably benign Het
Pla2g4e T G 2: 120,016,863 (GRCm39) H226P possibly damaging Het
Plxnd1 A T 6: 115,971,237 (GRCm39) V177E probably damaging Het
Prmt7 A G 8: 106,976,961 (GRCm39) S558G possibly damaging Het
Pspc1 A C 14: 57,015,246 (GRCm39) probably null Het
Rilp T C 11: 75,403,586 (GRCm39) S343P probably benign Het
Ror1 A G 4: 100,265,107 (GRCm39) M194V probably damaging Het
Rsu1 T C 2: 13,174,815 (GRCm39) Y225C probably damaging Het
Rundc1 A G 11: 101,324,752 (GRCm39) N486S probably damaging Het
Sema6d T A 2: 124,496,151 (GRCm39) I65N probably damaging Het
Slc5a11 A G 7: 122,857,601 (GRCm39) E230G probably benign Het
Spint1 T C 2: 119,076,941 (GRCm39) S342P probably damaging Het
Stard3nl A G 13: 19,551,923 (GRCm39) S214P probably damaging Het
Tcp10a A C 17: 7,604,323 (GRCm39) T271P probably damaging Het
Tie1 A G 4: 118,329,831 (GRCm39) Y1091H probably benign Het
Tlr12 T C 4: 128,511,125 (GRCm39) Y375C probably benign Het
Tmem107 T A 11: 68,962,274 (GRCm39) M77K probably damaging Het
Tns2 C T 15: 102,017,369 (GRCm39) R281C probably damaging Het
Tns3 T C 11: 8,481,747 (GRCm39) K202E probably damaging Het
Tspoap1 C T 11: 87,670,347 (GRCm39) P1634L probably damaging Het
Ttc7b G A 12: 100,466,376 (GRCm39) R79C probably damaging Het
Ush2a A G 1: 188,643,844 (GRCm39) N4402S probably benign Het
Vmn2r13 A T 5: 109,304,322 (GRCm39) I703N probably damaging Het
Xrcc4 A G 13: 90,210,126 (GRCm39) probably null Het
Zp3 A T 5: 136,013,089 (GRCm39) K168* probably null Het
Other mutations in Clock
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00598:Clock APN 5 76,377,311 (GRCm39) missense probably benign 0.17
IGL00725:Clock APN 5 76,402,260 (GRCm39) nonsense probably null
IGL01304:Clock APN 5 76,414,202 (GRCm39) critical splice donor site probably null
IGL01369:Clock APN 5 76,384,933 (GRCm39) missense probably benign 0.30
IGL01542:Clock APN 5 76,379,322 (GRCm39) missense possibly damaging 0.82
IGL02541:Clock APN 5 76,410,519 (GRCm39) splice site probably null
IGL02602:Clock APN 5 76,402,274 (GRCm39) missense probably damaging 1.00
IGL02602:Clock APN 5 76,402,273 (GRCm39) missense probably null 1.00
IGL03186:Clock APN 5 76,390,929 (GRCm39) missense probably damaging 0.98
IGL03309:Clock APN 5 76,379,241 (GRCm39) critical splice donor site probably null
R6760_Clock_188 UTSW 5 76,374,823 (GRCm39) missense unknown
uhr UTSW 5 76,377,401 (GRCm39) nonsense probably null
R0304:Clock UTSW 5 76,374,832 (GRCm39) missense unknown
R0593:Clock UTSW 5 76,413,683 (GRCm39) missense probably benign 0.25
R0654:Clock UTSW 5 76,374,976 (GRCm39) missense possibly damaging 0.95
R0684:Clock UTSW 5 76,393,365 (GRCm39) missense probably damaging 0.96
R0707:Clock UTSW 5 76,374,976 (GRCm39) missense possibly damaging 0.95
R0751:Clock UTSW 5 76,377,208 (GRCm39) missense possibly damaging 0.75
R0865:Clock UTSW 5 76,414,271 (GRCm39) splice site probably benign
R0920:Clock UTSW 5 76,378,167 (GRCm39) missense possibly damaging 0.80
R1396:Clock UTSW 5 76,414,649 (GRCm39) missense probably benign 0.00
R1450:Clock UTSW 5 76,410,578 (GRCm39) nonsense probably null
R1487:Clock UTSW 5 76,414,201 (GRCm39) splice site probably null
R1574:Clock UTSW 5 76,390,679 (GRCm39) missense probably damaging 1.00
R1574:Clock UTSW 5 76,390,679 (GRCm39) missense probably damaging 1.00
R1858:Clock UTSW 5 76,388,756 (GRCm39) missense possibly damaging 0.92
R1872:Clock UTSW 5 76,396,309 (GRCm39) missense possibly damaging 0.67
R1905:Clock UTSW 5 76,414,735 (GRCm39) splice site probably benign
R1937:Clock UTSW 5 76,377,340 (GRCm39) missense probably damaging 0.99
R2411:Clock UTSW 5 76,379,360 (GRCm39) missense probably benign 0.08
R2887:Clock UTSW 5 76,393,120 (GRCm39) missense probably damaging 0.99
R3410:Clock UTSW 5 76,377,401 (GRCm39) nonsense probably null
R4514:Clock UTSW 5 76,378,046 (GRCm39) missense probably benign 0.00
R4598:Clock UTSW 5 76,383,657 (GRCm39) missense probably benign 0.00
R4795:Clock UTSW 5 76,413,763 (GRCm39) missense probably damaging 1.00
R4796:Clock UTSW 5 76,413,763 (GRCm39) missense probably damaging 1.00
R4973:Clock UTSW 5 76,402,258 (GRCm39) missense possibly damaging 0.62
R5204:Clock UTSW 5 76,391,017 (GRCm39) splice site probably null
R5271:Clock UTSW 5 76,389,801 (GRCm39) missense probably damaging 1.00
R5547:Clock UTSW 5 76,378,185 (GRCm39) missense probably benign 0.02
R5630:Clock UTSW 5 76,378,185 (GRCm39) missense probably benign 0.02
R5631:Clock UTSW 5 76,378,185 (GRCm39) missense probably benign 0.02
R5632:Clock UTSW 5 76,378,185 (GRCm39) missense probably benign 0.02
R5787:Clock UTSW 5 76,384,898 (GRCm39) missense probably damaging 1.00
R6274:Clock UTSW 5 76,385,000 (GRCm39) missense probably benign 0.45
R6578:Clock UTSW 5 76,364,556 (GRCm39) missense unknown
R6622:Clock UTSW 5 76,389,801 (GRCm39) missense probably damaging 1.00
R6760:Clock UTSW 5 76,374,823 (GRCm39) missense unknown
R6793:Clock UTSW 5 76,384,967 (GRCm39) frame shift probably null
R7406:Clock UTSW 5 76,414,692 (GRCm39) start codon destroyed probably null 0.26
R7414:Clock UTSW 5 76,410,611 (GRCm39) missense probably benign 0.00
R7560:Clock UTSW 5 76,390,738 (GRCm39) splice site probably null
R7593:Clock UTSW 5 76,384,145 (GRCm39) missense possibly damaging 0.80
R7640:Clock UTSW 5 76,396,225 (GRCm39) missense possibly damaging 0.71
R7708:Clock UTSW 5 76,414,256 (GRCm39) missense probably benign 0.00
R7713:Clock UTSW 5 76,393,267 (GRCm39) critical splice donor site probably null
R7807:Clock UTSW 5 76,390,982 (GRCm39) missense probably benign 0.01
R8171:Clock UTSW 5 76,414,261 (GRCm39) missense possibly damaging 0.94
R8190:Clock UTSW 5 76,375,051 (GRCm39) missense probably damaging 0.98
R8225:Clock UTSW 5 76,389,759 (GRCm39) missense probably damaging 0.99
R8309:Clock UTSW 5 76,402,269 (GRCm39) missense probably benign 0.07
R8557:Clock UTSW 5 76,377,217 (GRCm39) missense probably damaging 1.00
R8792:Clock UTSW 5 76,410,574 (GRCm39) missense probably damaging 1.00
R8869:Clock UTSW 5 76,374,889 (GRCm39) small deletion probably benign
R8870:Clock UTSW 5 76,383,632 (GRCm39) missense probably benign 0.17
R8980:Clock UTSW 5 76,402,286 (GRCm39) missense probably benign 0.01
R8982:Clock UTSW 5 76,364,559 (GRCm39) missense unknown
R9177:Clock UTSW 5 76,377,256 (GRCm39) missense probably benign 0.00
R9208:Clock UTSW 5 76,384,871 (GRCm39) missense probably benign 0.00
R9213:Clock UTSW 5 76,393,376 (GRCm39) missense possibly damaging 0.94
R9307:Clock UTSW 5 76,364,671 (GRCm39) missense unknown
R9446:Clock UTSW 5 76,396,288 (GRCm39) missense probably benign 0.00
R9516:Clock UTSW 5 76,377,227 (GRCm39) missense possibly damaging 0.85
R9572:Clock UTSW 5 76,377,338 (GRCm39) missense probably benign 0.00
R9630:Clock UTSW 5 76,393,281 (GRCm39) missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- GATTCTTTCTAGTAAGGGTCCACC -3'
(R):5'- GGCAGCTCACTTTGTACTCAAC -3'

Sequencing Primer
(F):5'- GTAAGGGTCCACCAAAATCATTG -3'
(R):5'- TCAACAAAGTGAGGTTGATTGTCAG -3'
Posted On 2015-09-25