Incidental Mutation 'R4599:Zp3'
ID 345430
Institutional Source Beutler Lab
Gene Symbol Zp3
Ensembl Gene ENSMUSG00000004948
Gene Name zona pellucida glycoprotein 3
Synonyms Zp-3
MMRRC Submission 041815-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.113) question?
Stock # R4599 (G1)
Quality Score 225
Status Not validated
Chromosome 5
Chromosomal Location 135980099-135988624 bp(+) (GRCm38)
Type of Mutation nonsense
DNA Base Change (assembly) A to T at 135984235 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Lysine to Stop codon at position 168 (K168*)
Ref Sequence ENSEMBL: ENSMUSP00000005073 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000005073]
AlphaFold P10761
PDB Structure ZP-N domain of mammalian sperm receptor ZP3 (crystal form I) [X-RAY DIFFRACTION]
ZP-N domain of mammalian sperm receptor ZP3 (crystal form II) [X-RAY DIFFRACTION]
ZP-N domain of mammalian sperm receptor ZP3 (crystal form III) [X-RAY DIFFRACTION]
Predicted Effect probably null
Transcript: ENSMUST00000005073
AA Change: K168*
SMART Domains Protein: ENSMUSP00000005073
Gene: ENSMUSG00000004948
AA Change: K168*

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
ZP 45 304 1.22e-68 SMART
low complexity region 320 334 N/A INTRINSIC
transmembrane domain 387 409 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000131563
SMART Domains Protein: ENSMUSP00000120447
Gene: ENSMUSG00000004948

DomainStartEndE-ValueType
Pfam:Zona_pellucida 35 136 6.4e-16 PFAM
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The zona pellucida is an extracellular matrix that surrounds the oocyte and early embryo. It is composed primarily of three or four glycoproteins with various functions during fertilization and preimplantation development. The protein encoded by this gene is a structural component of the zona pellucida and functions in primary binding and induction of the sperm acrosome reaction. The nascent protein contains a N-terminal signal peptide sequence, a conserved ZP domain, a C-terminal consensus furin cleavage site, and a transmembrane domain. It is hypothesized that furin cleavage results in release of the mature protein from the plasma membrane for subsequent incorporation into the zona pellucida matrix. However, the requirement for furin cleavage in this process remains controversial based on mouse studies. A variation in the last exon of this gene has previously served as the basis for an additional ZP3 locus; however, sequence and literature review reveals that there is only one full-length ZP3 locus in the human genome. Another locus encoding a bipartite transcript designated POMZP3 contains a duplication of the last four exons of ZP3, including the above described variation, and maps closely to this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous female mutants are infertile. In these females oocytes lack a zona pellucida and cumulus-oocyte complexes are disrupted. Oocytes of heterozygous females have a thin zona, but females are fertile. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca14 T C 7: 120,255,403 V930A probably benign Het
Ankrd13b T C 11: 77,471,668 R677G probably benign Het
Apc T A 18: 34,317,987 Y2611* probably null Het
Apold1 A G 6: 134,984,069 Y162C probably damaging Het
Atp6v0a4 T C 6: 38,078,802 I325V probably benign Het
Cab39 A G 1: 85,848,329 Y249C probably damaging Het
Cd22 T A 7: 30,875,900 H239L probably damaging Het
Chrna7 A G 7: 63,103,790 M327T probably damaging Het
Clock T C 5: 76,235,810 M499V probably benign Het
Clspn A G 4: 126,581,460 E1002G probably benign Het
Clta C T 4: 44,012,819 P10S probably damaging Het
Col5a3 A G 9: 20,774,559 probably null Het
Coq6 T C 12: 84,362,139 V30A probably benign Het
Csmd2 G T 4: 127,988,128 R20L probably benign Het
D430041D05Rik A T 2: 104,208,183 V1547D probably damaging Het
Dapk1 C T 13: 60,718,047 P153S probably benign Het
Dock2 T A 11: 34,239,536 Y1545F probably damaging Het
Dpp6 G T 5: 27,634,548 G354C probably damaging Het
Dyrk1b T C 7: 28,182,431 L105P probably damaging Het
Epor A G 9: 21,961,859 S86P probably benign Het
Fam166b T C 4: 43,427,574 H250R possibly damaging Het
Gale C A 4: 135,967,837 S341* probably null Het
Galnt4 T A 10: 99,109,493 V360E probably damaging Het
Gart A T 16: 91,622,945 C24* probably null Het
Gcnt2 G T 13: 40,887,490 V42L probably benign Het
Herc6 A G 6: 57,659,713 I805V probably benign Het
Ints12 T A 3: 133,098,453 I67N probably benign Het
Irx1 C A 13: 71,960,113 R150L probably damaging Het
Kif26b A G 1: 178,530,459 Y45C unknown Het
Krt35 T C 11: 100,094,008 T275A probably damaging Het
Laptm5 G T 4: 130,916,005 probably benign Het
Lin7a T C 10: 107,412,166 S111P unknown Het
Med27 A G 2: 29,524,458 D159G probably damaging Het
Msh2 A G 17: 87,708,578 K546R probably damaging Het
Myo1a A T 10: 127,720,151 probably null Het
Myo1c T C 11: 75,668,193 F604L probably damaging Het
Myrip A G 9: 120,464,784 K782E probably damaging Het
Ndc80 T C 17: 71,521,068 D88G probably damaging Het
Nrxn2 A G 19: 6,455,252 D375G probably damaging Het
Olfr1380 T C 11: 49,564,718 S266P probably damaging Het
Olfr676 A G 7: 105,036,073 I292V probably benign Het
Padi3 T C 4: 140,798,111 H187R probably damaging Het
Pcdhgb1 A T 18: 37,681,557 N367I probably damaging Het
Pdrg1 T C 2: 153,012,390 I77V probably benign Het
Pfas T C 11: 68,991,069 E930G probably benign Het
Pik3cb C T 9: 99,061,764 R662Q probably benign Het
Pla2g4e T G 2: 120,186,382 H226P possibly damaging Het
Plxnd1 A T 6: 115,994,276 V177E probably damaging Het
Prmt7 A G 8: 106,250,329 S558G possibly damaging Het
Pspc1 A C 14: 56,777,789 probably null Het
Rilp T C 11: 75,512,760 S343P probably benign Het
Ror1 A G 4: 100,407,910 M194V probably damaging Het
Rsu1 T C 2: 13,170,004 Y225C probably damaging Het
Rundc1 A G 11: 101,433,926 N486S probably damaging Het
Sema6d T A 2: 124,654,231 I65N probably damaging Het
Slc5a11 A G 7: 123,258,378 E230G probably benign Het
Spint1 T C 2: 119,246,460 S342P probably damaging Het
Stard3nl A G 13: 19,367,753 S214P probably damaging Het
Tcp10a A C 17: 7,336,924 T271P probably damaging Het
Tie1 A G 4: 118,472,634 Y1091H probably benign Het
Tlr12 T C 4: 128,617,332 Y375C probably benign Het
Tmem107 T A 11: 69,071,448 M77K probably damaging Het
Tns2 C T 15: 102,108,934 R281C probably damaging Het
Tns3 T C 11: 8,531,747 K202E probably damaging Het
Tspoap1 C T 11: 87,779,521 P1634L probably damaging Het
Ttc7b G A 12: 100,500,117 R79C probably damaging Het
Ush2a A G 1: 188,911,647 N4402S probably benign Het
Vmn2r13 A T 5: 109,156,456 I703N probably damaging Het
Xrcc4 A G 13: 90,062,007 probably null Het
Other mutations in Zp3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02282:Zp3 APN 5 135984351 missense possibly damaging 0.72
IGL02563:Zp3 APN 5 135987610 critical splice donor site probably null
IGL03185:Zp3 APN 5 135982721 missense possibly damaging 0.94
PIT4280001:Zp3 UTSW 5 135984464 missense possibly damaging 0.56
R0646:Zp3 UTSW 5 135984356 missense possibly damaging 0.46
R1454:Zp3 UTSW 5 135984188 missense probably damaging 1.00
R1691:Zp3 UTSW 5 135980281 missense possibly damaging 0.86
R3415:Zp3 UTSW 5 135985660 missense probably benign 0.07
R4987:Zp3 UTSW 5 135987505 nonsense probably null
R5907:Zp3 UTSW 5 135988523 missense probably benign 0.00
R6388:Zp3 UTSW 5 135982694 missense probably benign 0.02
R6587:Zp3 UTSW 5 135987498 missense possibly damaging 0.68
R6629:Zp3 UTSW 5 135987336 missense probably benign 0.00
R7438:Zp3 UTSW 5 135982705 missense probably damaging 1.00
R8050:Zp3 UTSW 5 135982750 missense probably damaging 1.00
R8083:Zp3 UTSW 5 135984522 missense probably damaging 1.00
R8158:Zp3 UTSW 5 135985564 missense probably benign 0.15
R8421:Zp3 UTSW 5 135988477 missense probably benign 0.00
R8447:Zp3 UTSW 5 135984390 missense probably damaging 1.00
R8529:Zp3 UTSW 5 135987265 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GAGTTTATCCATCTCTGAGATCTCTG -3'
(R):5'- AGTGGTCCACAAACAGCTGC -3'

Sequencing Primer
(F):5'- CCATCTCTGAGATCTCTGTAATAGGG -3'
(R):5'- CAGTCTGGACTTCTGCCTGGAG -3'
Posted On 2015-09-25