Incidental Mutation 'R4599:Dyrk1b'
ID 345436
Institutional Source Beutler Lab
Gene Symbol Dyrk1b
Ensembl Gene ENSMUSG00000002409
Gene Name dual-specificity tyrosine phosphorylation regulated kinase 1b
Synonyms Mirk
MMRRC Submission 041815-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R4599 (G1)
Quality Score 225
Status Not validated
Chromosome 7
Chromosomal Location 27878894-27886719 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 27881856 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Leucine to Proline at position 105 (L105P)
Ref Sequence ENSEMBL: ENSMUSP00000133431 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042405] [ENSMUST00000085901] [ENSMUST00000172467] [ENSMUST00000172761]
AlphaFold Q9Z188
Predicted Effect probably benign
Transcript: ENSMUST00000042405
SMART Domains Protein: ENSMUSP00000037613
Gene: ENSMUSG00000046865

DomainStartEndE-ValueType
low complexity region 8 85 N/A INTRINSIC
Fibrillarin 94 321 9.92e-176 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000085901
AA Change: L45P

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000083064
Gene: ENSMUSG00000002409
AA Change: L45P

DomainStartEndE-ValueType
low complexity region 4 16 N/A INTRINSIC
low complexity region 22 41 N/A INTRINSIC
S_TKc 111 431 3.75e-78 SMART
low complexity region 438 454 N/A INTRINSIC
low complexity region 460 477 N/A INTRINSIC
low complexity region 542 561 N/A INTRINSIC
low complexity region 571 591 N/A INTRINSIC
low complexity region 597 615 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000172467
AA Change: L105P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000133431
Gene: ENSMUSG00000002409
AA Change: L105P

DomainStartEndE-ValueType
low complexity region 4 16 N/A INTRINSIC
low complexity region 22 41 N/A INTRINSIC
S_TKc 111 431 3.75e-78 SMART
low complexity region 438 454 N/A INTRINSIC
low complexity region 460 477 N/A INTRINSIC
low complexity region 542 561 N/A INTRINSIC
low complexity region 571 591 N/A INTRINSIC
low complexity region 597 615 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000172761
AA Change: L45P

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000133719
Gene: ENSMUSG00000002409
AA Change: L45P

DomainStartEndE-ValueType
low complexity region 4 16 N/A INTRINSIC
low complexity region 22 41 N/A INTRINSIC
S_TKc 111 391 1.52e-78 SMART
low complexity region 398 414 N/A INTRINSIC
low complexity region 420 437 N/A INTRINSIC
low complexity region 502 521 N/A INTRINSIC
low complexity region 531 551 N/A INTRINSIC
low complexity region 557 575 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000173223
AA Change: L45P

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000133364
Gene: ENSMUSG00000002409
AA Change: L45P

DomainStartEndE-ValueType
low complexity region 4 16 N/A INTRINSIC
low complexity region 22 41 N/A INTRINSIC
S_TKc 111 431 3.75e-78 SMART
low complexity region 438 454 N/A INTRINSIC
low complexity region 460 477 N/A INTRINSIC
low complexity region 542 561 N/A INTRINSIC
low complexity region 571 591 N/A INTRINSIC
low complexity region 597 615 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000208259
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of a family of nuclear-localized protein kinases. The encoded protein participates in the regulation of the cell cycle. Expression of this gene may be altered in tumor cells, and mutations in this gene were found to cause abdominal obesity-metabolic syndrome 3. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jun 2014]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca14 T C 7: 119,854,626 (GRCm39) V930A probably benign Het
Ankrd13b T C 11: 77,362,494 (GRCm39) R677G probably benign Het
Apc T A 18: 34,451,040 (GRCm39) Y2611* probably null Het
Apold1 A G 6: 134,961,032 (GRCm39) Y162C probably damaging Het
Atp6v0a4 T C 6: 38,055,737 (GRCm39) I325V probably benign Het
Cab39 A G 1: 85,776,050 (GRCm39) Y249C probably damaging Het
Cd22 T A 7: 30,575,325 (GRCm39) H239L probably damaging Het
Chrna7 A G 7: 62,753,538 (GRCm39) M327T probably damaging Het
Cimip2b T C 4: 43,427,574 (GRCm39) H250R possibly damaging Het
Clock T C 5: 76,383,657 (GRCm39) M499V probably benign Het
Clspn A G 4: 126,475,253 (GRCm39) E1002G probably benign Het
Clta C T 4: 44,012,819 (GRCm39) P10S probably damaging Het
Col5a3 A G 9: 20,685,855 (GRCm39) probably null Het
Coq6 T C 12: 84,408,913 (GRCm39) V30A probably benign Het
Csmd2 G T 4: 127,881,921 (GRCm39) R20L probably benign Het
D430041D05Rik A T 2: 104,038,528 (GRCm39) V1547D probably damaging Het
Dapk1 C T 13: 60,865,861 (GRCm39) P153S probably benign Het
Dock2 T A 11: 34,189,536 (GRCm39) Y1545F probably damaging Het
Dpp6 G T 5: 27,839,546 (GRCm39) G354C probably damaging Het
Epor A G 9: 21,873,155 (GRCm39) S86P probably benign Het
Gale C A 4: 135,695,148 (GRCm39) S341* probably null Het
Galnt4 T A 10: 98,945,355 (GRCm39) V360E probably damaging Het
Gart A T 16: 91,419,833 (GRCm39) C24* probably null Het
Gcnt2 G T 13: 41,040,966 (GRCm39) V42L probably benign Het
Herc6 A G 6: 57,636,698 (GRCm39) I805V probably benign Het
Ints12 T A 3: 132,804,214 (GRCm39) I67N probably benign Het
Irx1 C A 13: 72,108,232 (GRCm39) R150L probably damaging Het
Kif26b A G 1: 178,358,024 (GRCm39) Y45C unknown Het
Krt35 T C 11: 99,984,834 (GRCm39) T275A probably damaging Het
Laptm5 G T 4: 130,643,316 (GRCm39) probably benign Het
Lin7a T C 10: 107,248,027 (GRCm39) S111P unknown Het
Med27 A G 2: 29,414,470 (GRCm39) D159G probably damaging Het
Msh2 A G 17: 88,016,006 (GRCm39) K546R probably damaging Het
Myo1a A T 10: 127,556,020 (GRCm39) probably null Het
Myo1c T C 11: 75,559,019 (GRCm39) F604L probably damaging Het
Myrip A G 9: 120,293,850 (GRCm39) K782E probably damaging Het
Ndc80 T C 17: 71,828,063 (GRCm39) D88G probably damaging Het
Nrxn2 A G 19: 6,505,282 (GRCm39) D375G probably damaging Het
Or2y10 T C 11: 49,455,545 (GRCm39) S266P probably damaging Het
Or52e7 A G 7: 104,685,280 (GRCm39) I292V probably benign Het
Padi3 T C 4: 140,525,422 (GRCm39) H187R probably damaging Het
Pcdhgb1 A T 18: 37,814,610 (GRCm39) N367I probably damaging Het
Pdrg1 T C 2: 152,854,310 (GRCm39) I77V probably benign Het
Pfas T C 11: 68,881,895 (GRCm39) E930G probably benign Het
Pik3cb C T 9: 98,943,817 (GRCm39) R662Q probably benign Het
Pla2g4e T G 2: 120,016,863 (GRCm39) H226P possibly damaging Het
Plxnd1 A T 6: 115,971,237 (GRCm39) V177E probably damaging Het
Prmt7 A G 8: 106,976,961 (GRCm39) S558G possibly damaging Het
Pspc1 A C 14: 57,015,246 (GRCm39) probably null Het
Rilp T C 11: 75,403,586 (GRCm39) S343P probably benign Het
Ror1 A G 4: 100,265,107 (GRCm39) M194V probably damaging Het
Rsu1 T C 2: 13,174,815 (GRCm39) Y225C probably damaging Het
Rundc1 A G 11: 101,324,752 (GRCm39) N486S probably damaging Het
Sema6d T A 2: 124,496,151 (GRCm39) I65N probably damaging Het
Slc5a11 A G 7: 122,857,601 (GRCm39) E230G probably benign Het
Spint1 T C 2: 119,076,941 (GRCm39) S342P probably damaging Het
Stard3nl A G 13: 19,551,923 (GRCm39) S214P probably damaging Het
Tcp10a A C 17: 7,604,323 (GRCm39) T271P probably damaging Het
Tie1 A G 4: 118,329,831 (GRCm39) Y1091H probably benign Het
Tlr12 T C 4: 128,511,125 (GRCm39) Y375C probably benign Het
Tmem107 T A 11: 68,962,274 (GRCm39) M77K probably damaging Het
Tns2 C T 15: 102,017,369 (GRCm39) R281C probably damaging Het
Tns3 T C 11: 8,481,747 (GRCm39) K202E probably damaging Het
Tspoap1 C T 11: 87,670,347 (GRCm39) P1634L probably damaging Het
Ttc7b G A 12: 100,466,376 (GRCm39) R79C probably damaging Het
Ush2a A G 1: 188,643,844 (GRCm39) N4402S probably benign Het
Vmn2r13 A T 5: 109,304,322 (GRCm39) I703N probably damaging Het
Xrcc4 A G 13: 90,210,126 (GRCm39) probably null Het
Zp3 A T 5: 136,013,089 (GRCm39) K168* probably null Het
Other mutations in Dyrk1b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01483:Dyrk1b APN 7 27,882,101 (GRCm39) missense probably damaging 0.96
IGL01820:Dyrk1b APN 7 27,881,025 (GRCm39) utr 5 prime probably benign
IGL03155:Dyrk1b APN 7 27,882,112 (GRCm39) missense probably benign 0.25
R0280:Dyrk1b UTSW 7 27,883,737 (GRCm39) missense probably damaging 1.00
R0323:Dyrk1b UTSW 7 27,884,781 (GRCm39) missense probably benign 0.00
R0610:Dyrk1b UTSW 7 27,886,059 (GRCm39) missense probably damaging 0.99
R0765:Dyrk1b UTSW 7 27,885,136 (GRCm39) intron probably benign
R1858:Dyrk1b UTSW 7 27,882,071 (GRCm39) splice site probably null
R2354:Dyrk1b UTSW 7 27,884,797 (GRCm39) missense possibly damaging 0.79
R4655:Dyrk1b UTSW 7 27,885,176 (GRCm39) missense probably damaging 0.97
R5201:Dyrk1b UTSW 7 27,884,521 (GRCm39) missense probably damaging 1.00
R5357:Dyrk1b UTSW 7 27,884,743 (GRCm39) missense possibly damaging 0.79
R5560:Dyrk1b UTSW 7 27,883,678 (GRCm39) missense possibly damaging 0.53
R6171:Dyrk1b UTSW 7 27,885,975 (GRCm39) critical splice acceptor site probably null
R6751:Dyrk1b UTSW 7 27,886,134 (GRCm39) missense probably damaging 1.00
R6901:Dyrk1b UTSW 7 27,884,542 (GRCm39) missense probably damaging 1.00
R6918:Dyrk1b UTSW 7 27,885,350 (GRCm39) missense probably damaging 0.99
R7699:Dyrk1b UTSW 7 27,883,737 (GRCm39) missense probably damaging 1.00
R7700:Dyrk1b UTSW 7 27,883,737 (GRCm39) missense probably damaging 1.00
R8177:Dyrk1b UTSW 7 27,882,601 (GRCm39) missense possibly damaging 0.86
R8271:Dyrk1b UTSW 7 27,882,080 (GRCm39) missense probably benign 0.02
R9241:Dyrk1b UTSW 7 27,886,058 (GRCm39) missense probably benign 0.00
R9582:Dyrk1b UTSW 7 27,882,028 (GRCm39) missense probably damaging 0.99
R9644:Dyrk1b UTSW 7 27,881,790 (GRCm39) missense probably damaging 0.99
R9701:Dyrk1b UTSW 7 27,885,838 (GRCm39) missense probably damaging 1.00
X0060:Dyrk1b UTSW 7 27,882,575 (GRCm39) missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- CACACAGTGTGCTTGTGCTC -3'
(R):5'- TCGTCATCATAACCGTGGTTC -3'

Sequencing Primer
(F):5'- CACAGTGTGCTTGTGCTCTACAG -3'
(R):5'- TCATAACCGTGGTTCAGGAC -3'
Posted On 2015-09-25