Incidental Mutation 'R4599:Cd22'
ID 345437
Institutional Source Beutler Lab
Gene Symbol Cd22
Ensembl Gene ENSMUSG00000030577
Gene Name CD22 antigen
Synonyms Lyb8, Lyb-8
MMRRC Submission 041815-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R4599 (G1)
Quality Score 225
Status Not validated
Chromosome 7
Chromosomal Location 30564829-30579767 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 30575325 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Histidine to Leucine at position 239 (H239L)
Ref Sequence ENSEMBL: ENSMUSP00000140528 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000019248] [ENSMUST00000108125] [ENSMUST00000186154] [ENSMUST00000190617] [ENSMUST00000189718] [ENSMUST00000190646] [ENSMUST00000214289] [ENSMUST00000187989] [ENSMUST00000188157] [ENSMUST00000190753]
AlphaFold no structure available at present
Predicted Effect possibly damaging
Transcript: ENSMUST00000019248
AA Change: H239L

PolyPhen 2 Score 0.853 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000019248
Gene: ENSMUSG00000030577
AA Change: H239L

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
IG 31 147 2.75e-1 SMART
IG_like 156 254 4.07e1 SMART
IGc2 269 337 2.68e-4 SMART
IGc2 365 424 4.52e-11 SMART
IG 448 523 1.21e-2 SMART
IGc2 541 599 6.75e-10 SMART
IGc2 628 687 2.68e-4 SMART
transmembrane domain 709 726 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000108125
AA Change: H239L

PolyPhen 2 Score 0.853 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000103760
Gene: ENSMUSG00000030577
AA Change: H239L

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
IG 31 147 2.75e-1 SMART
IG_like 156 254 4.07e1 SMART
IGc2 269 337 2.68e-4 SMART
IGc2 365 424 4.52e-11 SMART
IG 448 523 1.21e-2 SMART
IGc2 541 599 6.75e-10 SMART
IGc2 628 687 2.68e-4 SMART
transmembrane domain 709 726 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000186154
AA Change: H239L

PolyPhen 2 Score 0.853 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000139685
Gene: ENSMUSG00000030577
AA Change: H239L

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
IG 31 147 2.75e-1 SMART
IG_like 156 254 4.07e1 SMART
IGc2 269 337 2.68e-4 SMART
IGc2 365 424 4.52e-11 SMART
IG 448 523 1.21e-2 SMART
IGc2 541 599 6.75e-10 SMART
IGc2 628 687 2.68e-4 SMART
transmembrane domain 709 726 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000186333
Predicted Effect noncoding transcript
Transcript: ENSMUST00000186354
Predicted Effect noncoding transcript
Transcript: ENSMUST00000187436
Predicted Effect possibly damaging
Transcript: ENSMUST00000190617
AA Change: H239L

PolyPhen 2 Score 0.853 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000139871
Gene: ENSMUSG00000030577
AA Change: H239L

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
IG 31 147 2.75e-1 SMART
IG_like 156 254 4.07e1 SMART
IGc2 269 337 2.68e-4 SMART
IGc2 365 424 4.52e-11 SMART
IG 448 523 1.21e-2 SMART
IGc2 541 599 6.75e-10 SMART
IGc2 628 687 2.68e-4 SMART
transmembrane domain 709 726 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000189718
AA Change: H239L

PolyPhen 2 Score 0.853 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000140521
Gene: ENSMUSG00000030577
AA Change: H239L

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
IG 31 147 2.75e-1 SMART
IG_like 156 254 4.07e1 SMART
IGc2 269 337 2.68e-4 SMART
IGc2 365 424 4.52e-11 SMART
IG 448 523 1.21e-2 SMART
IGc2 541 599 6.75e-10 SMART
IGc2 628 687 2.68e-4 SMART
transmembrane domain 709 726 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000190646
AA Change: H239L

PolyPhen 2 Score 0.978 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000140528
Gene: ENSMUSG00000030577
AA Change: H239L

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
IG 31 147 1.1e-3 SMART
IG_like 166 245 1.6e-2 SMART
IGc2 269 337 1.1e-6 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000190170
Predicted Effect noncoding transcript
Transcript: ENSMUST00000187585
Predicted Effect noncoding transcript
Transcript: ENSMUST00000189996
Predicted Effect unknown
Transcript: ENSMUST00000214289
AA Change: H239L
Predicted Effect probably benign
Transcript: ENSMUST00000190455
Predicted Effect probably benign
Transcript: ENSMUST00000187989
Predicted Effect probably benign
Transcript: ENSMUST00000188157
SMART Domains Protein: ENSMUSP00000140450
Gene: ENSMUSG00000030577

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
IG 31 147 1.1e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000190753
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygous null mice have reduced mature B cell numbers with altered proliferation kinetics and reduced antibody production to T cell independent antigens. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca14 T C 7: 119,854,626 (GRCm39) V930A probably benign Het
Ankrd13b T C 11: 77,362,494 (GRCm39) R677G probably benign Het
Apc T A 18: 34,451,040 (GRCm39) Y2611* probably null Het
Apold1 A G 6: 134,961,032 (GRCm39) Y162C probably damaging Het
Atp6v0a4 T C 6: 38,055,737 (GRCm39) I325V probably benign Het
Cab39 A G 1: 85,776,050 (GRCm39) Y249C probably damaging Het
Chrna7 A G 7: 62,753,538 (GRCm39) M327T probably damaging Het
Cimip2b T C 4: 43,427,574 (GRCm39) H250R possibly damaging Het
Clock T C 5: 76,383,657 (GRCm39) M499V probably benign Het
Clspn A G 4: 126,475,253 (GRCm39) E1002G probably benign Het
Clta C T 4: 44,012,819 (GRCm39) P10S probably damaging Het
Col5a3 A G 9: 20,685,855 (GRCm39) probably null Het
Coq6 T C 12: 84,408,913 (GRCm39) V30A probably benign Het
Csmd2 G T 4: 127,881,921 (GRCm39) R20L probably benign Het
D430041D05Rik A T 2: 104,038,528 (GRCm39) V1547D probably damaging Het
Dapk1 C T 13: 60,865,861 (GRCm39) P153S probably benign Het
Dock2 T A 11: 34,189,536 (GRCm39) Y1545F probably damaging Het
Dpp6 G T 5: 27,839,546 (GRCm39) G354C probably damaging Het
Dyrk1b T C 7: 27,881,856 (GRCm39) L105P probably damaging Het
Epor A G 9: 21,873,155 (GRCm39) S86P probably benign Het
Gale C A 4: 135,695,148 (GRCm39) S341* probably null Het
Galnt4 T A 10: 98,945,355 (GRCm39) V360E probably damaging Het
Gart A T 16: 91,419,833 (GRCm39) C24* probably null Het
Gcnt2 G T 13: 41,040,966 (GRCm39) V42L probably benign Het
Herc6 A G 6: 57,636,698 (GRCm39) I805V probably benign Het
Ints12 T A 3: 132,804,214 (GRCm39) I67N probably benign Het
Irx1 C A 13: 72,108,232 (GRCm39) R150L probably damaging Het
Kif26b A G 1: 178,358,024 (GRCm39) Y45C unknown Het
Krt35 T C 11: 99,984,834 (GRCm39) T275A probably damaging Het
Laptm5 G T 4: 130,643,316 (GRCm39) probably benign Het
Lin7a T C 10: 107,248,027 (GRCm39) S111P unknown Het
Med27 A G 2: 29,414,470 (GRCm39) D159G probably damaging Het
Msh2 A G 17: 88,016,006 (GRCm39) K546R probably damaging Het
Myo1a A T 10: 127,556,020 (GRCm39) probably null Het
Myo1c T C 11: 75,559,019 (GRCm39) F604L probably damaging Het
Myrip A G 9: 120,293,850 (GRCm39) K782E probably damaging Het
Ndc80 T C 17: 71,828,063 (GRCm39) D88G probably damaging Het
Nrxn2 A G 19: 6,505,282 (GRCm39) D375G probably damaging Het
Or2y10 T C 11: 49,455,545 (GRCm39) S266P probably damaging Het
Or52e7 A G 7: 104,685,280 (GRCm39) I292V probably benign Het
Padi3 T C 4: 140,525,422 (GRCm39) H187R probably damaging Het
Pcdhgb1 A T 18: 37,814,610 (GRCm39) N367I probably damaging Het
Pdrg1 T C 2: 152,854,310 (GRCm39) I77V probably benign Het
Pfas T C 11: 68,881,895 (GRCm39) E930G probably benign Het
Pik3cb C T 9: 98,943,817 (GRCm39) R662Q probably benign Het
Pla2g4e T G 2: 120,016,863 (GRCm39) H226P possibly damaging Het
Plxnd1 A T 6: 115,971,237 (GRCm39) V177E probably damaging Het
Prmt7 A G 8: 106,976,961 (GRCm39) S558G possibly damaging Het
Pspc1 A C 14: 57,015,246 (GRCm39) probably null Het
Rilp T C 11: 75,403,586 (GRCm39) S343P probably benign Het
Ror1 A G 4: 100,265,107 (GRCm39) M194V probably damaging Het
Rsu1 T C 2: 13,174,815 (GRCm39) Y225C probably damaging Het
Rundc1 A G 11: 101,324,752 (GRCm39) N486S probably damaging Het
Sema6d T A 2: 124,496,151 (GRCm39) I65N probably damaging Het
Slc5a11 A G 7: 122,857,601 (GRCm39) E230G probably benign Het
Spint1 T C 2: 119,076,941 (GRCm39) S342P probably damaging Het
Stard3nl A G 13: 19,551,923 (GRCm39) S214P probably damaging Het
Tcp10a A C 17: 7,604,323 (GRCm39) T271P probably damaging Het
Tie1 A G 4: 118,329,831 (GRCm39) Y1091H probably benign Het
Tlr12 T C 4: 128,511,125 (GRCm39) Y375C probably benign Het
Tmem107 T A 11: 68,962,274 (GRCm39) M77K probably damaging Het
Tns2 C T 15: 102,017,369 (GRCm39) R281C probably damaging Het
Tns3 T C 11: 8,481,747 (GRCm39) K202E probably damaging Het
Tspoap1 C T 11: 87,670,347 (GRCm39) P1634L probably damaging Het
Ttc7b G A 12: 100,466,376 (GRCm39) R79C probably damaging Het
Ush2a A G 1: 188,643,844 (GRCm39) N4402S probably benign Het
Vmn2r13 A T 5: 109,304,322 (GRCm39) I703N probably damaging Het
Xrcc4 A G 13: 90,210,126 (GRCm39) probably null Het
Zp3 A T 5: 136,013,089 (GRCm39) K168* probably null Het
Other mutations in Cd22
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00714:Cd22 APN 7 30,575,572 (GRCm39) missense probably benign 0.01
IGL02236:Cd22 APN 7 30,566,893 (GRCm39) missense possibly damaging 0.54
IGL02321:Cd22 APN 7 30,569,308 (GRCm39) missense probably damaging 1.00
IGL02335:Cd22 APN 7 30,575,559 (GRCm39) missense probably damaging 1.00
IGL02397:Cd22 APN 7 30,577,050 (GRCm39) missense probably benign
IGL02402:Cd22 APN 7 30,576,955 (GRCm39) missense possibly damaging 0.86
IGL02538:Cd22 APN 7 30,576,985 (GRCm39) missense probably benign 0.40
IGL02736:Cd22 APN 7 30,577,470 (GRCm39) splice site probably null
blitz UTSW 7 30,569,329 (GRCm39) missense probably damaging 1.00
crullers UTSW 7 30,569,308 (GRCm39) missense probably damaging 1.00
gansu UTSW 7 30,569,530 (GRCm39) missense probably damaging 1.00
lacrima UTSW 7 30,575,578 (GRCm39) missense probably damaging 1.00
Lluvia UTSW 7 30,569,912 (GRCm39) missense possibly damaging 0.48
Mist UTSW 7 30,566,083 (GRCm39) missense probably damaging 1.00
rain UTSW 7 30,576,959 (GRCm39) missense probably damaging 1.00
well UTSW 7 30,577,212 (GRCm39) nonsense probably null
Yosemite UTSW 7 30,568,934 (GRCm39) critical splice donor site probably null
FR4304:Cd22 UTSW 7 30,577,507 (GRCm39) missense possibly damaging 0.95
FR4340:Cd22 UTSW 7 30,577,507 (GRCm39) missense possibly damaging 0.95
FR4342:Cd22 UTSW 7 30,577,507 (GRCm39) missense possibly damaging 0.95
FR4589:Cd22 UTSW 7 30,577,507 (GRCm39) missense possibly damaging 0.95
LCD18:Cd22 UTSW 7 30,577,507 (GRCm39) missense possibly damaging 0.95
PIT4142001:Cd22 UTSW 7 30,577,224 (GRCm39) missense possibly damaging 0.92
R0123:Cd22 UTSW 7 30,566,533 (GRCm39) splice site probably benign
R0130:Cd22 UTSW 7 30,569,389 (GRCm39) missense possibly damaging 0.92
R0926:Cd22 UTSW 7 30,568,934 (GRCm39) critical splice donor site probably null
R1245:Cd22 UTSW 7 30,569,308 (GRCm39) missense probably damaging 1.00
R1332:Cd22 UTSW 7 30,569,912 (GRCm39) missense possibly damaging 0.48
R1457:Cd22 UTSW 7 30,572,595 (GRCm39) missense probably benign 0.07
R1716:Cd22 UTSW 7 30,577,103 (GRCm39) missense probably damaging 1.00
R1980:Cd22 UTSW 7 30,572,658 (GRCm39) missense probably damaging 1.00
R2017:Cd22 UTSW 7 30,572,205 (GRCm39) missense probably damaging 0.99
R2061:Cd22 UTSW 7 30,575,581 (GRCm39) missense probably benign 0.03
R2061:Cd22 UTSW 7 30,569,530 (GRCm39) missense probably damaging 1.00
R2075:Cd22 UTSW 7 30,569,123 (GRCm39) missense probably damaging 1.00
R2216:Cd22 UTSW 7 30,566,471 (GRCm39) missense probably damaging 1.00
R3886:Cd22 UTSW 7 30,569,532 (GRCm39) missense possibly damaging 0.57
R4701:Cd22 UTSW 7 30,575,578 (GRCm39) missense probably damaging 1.00
R4796:Cd22 UTSW 7 30,572,381 (GRCm39) splice site probably null
R5179:Cd22 UTSW 7 30,575,299 (GRCm39) missense possibly damaging 0.81
R5233:Cd22 UTSW 7 30,576,959 (GRCm39) missense probably damaging 1.00
R5456:Cd22 UTSW 7 30,575,464 (GRCm39) missense probably benign 0.02
R5511:Cd22 UTSW 7 30,569,496 (GRCm39) missense probably damaging 1.00
R5513:Cd22 UTSW 7 30,566,450 (GRCm39) missense probably damaging 0.99
R5611:Cd22 UTSW 7 30,577,575 (GRCm39) unclassified probably benign
R5656:Cd22 UTSW 7 30,569,198 (GRCm39) missense probably damaging 1.00
R5966:Cd22 UTSW 7 30,566,083 (GRCm39) missense probably damaging 1.00
R6329:Cd22 UTSW 7 30,577,193 (GRCm39) missense probably damaging 0.99
R6356:Cd22 UTSW 7 30,577,127 (GRCm39) missense probably damaging 1.00
R6455:Cd22 UTSW 7 30,575,578 (GRCm39) missense probably damaging 1.00
R6550:Cd22 UTSW 7 30,576,977 (GRCm39) missense probably benign 0.00
R6656:Cd22 UTSW 7 30,577,182 (GRCm39) missense probably benign 0.11
R6688:Cd22 UTSW 7 30,572,389 (GRCm39) missense possibly damaging 0.91
R6844:Cd22 UTSW 7 30,572,856 (GRCm39) splice site probably null
R6957:Cd22 UTSW 7 30,566,999 (GRCm39) missense possibly damaging 0.88
R7068:Cd22 UTSW 7 30,577,504 (GRCm39) missense probably benign 0.03
R7083:Cd22 UTSW 7 30,567,473 (GRCm39) missense probably damaging 0.99
R7225:Cd22 UTSW 7 30,577,059 (GRCm39) missense not run
R7732:Cd22 UTSW 7 30,569,482 (GRCm39) missense probably damaging 1.00
R8686:Cd22 UTSW 7 30,569,494 (GRCm39) missense probably benign 0.03
R8851:Cd22 UTSW 7 30,577,084 (GRCm39) missense probably benign 0.01
R8987:Cd22 UTSW 7 30,577,172 (GRCm39) missense probably damaging 1.00
R9051:Cd22 UTSW 7 30,575,449 (GRCm39) missense probably benign
R9098:Cd22 UTSW 7 30,567,391 (GRCm39) missense probably benign 0.00
R9124:Cd22 UTSW 7 30,572,662 (GRCm39) missense probably benign 0.01
R9167:Cd22 UTSW 7 30,575,430 (GRCm39) missense probably benign 0.07
R9319:Cd22 UTSW 7 30,569,329 (GRCm39) missense probably damaging 1.00
R9369:Cd22 UTSW 7 30,576,999 (GRCm39) missense probably benign 0.09
X0025:Cd22 UTSW 7 30,572,844 (GRCm39) splice site probably null
Z1176:Cd22 UTSW 7 30,568,955 (GRCm39) missense probably damaging 1.00
Z1176:Cd22 UTSW 7 30,567,388 (GRCm39) missense probably benign 0.03
Z1186:Cd22 UTSW 7 30,566,891 (GRCm39) missense probably benign
Z1186:Cd22 UTSW 7 30,566,478 (GRCm39) missense probably benign 0.01
Z1186:Cd22 UTSW 7 30,575,292 (GRCm39) missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- CAGAAGAGACAGTTGTGCCAC -3'
(R):5'- GACCTGTGGACTGAATTTCTCC -3'

Sequencing Primer
(F):5'- GCCACCGCAGAAACAGGTG -3'
(R):5'- TGGGTATGACATCCTCTTGAAG -3'
Posted On 2015-09-25