Incidental Mutation 'R4599:Olfr676'
ID345439
Institutional Source Beutler Lab
Gene Symbol Olfr676
Ensembl Gene ENSMUSG00000073915
Gene Nameolfactory receptor 676
SynonymsMOR32-1, GA_x6K02T2PBJ9-7664016-7664969
MMRRC Submission 041815-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.063) question?
Stock #R4599 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location105032698-105037750 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 105036073 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 292 (I292V)
Ref Sequence ENSEMBL: ENSMUSP00000151474 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000098162] [ENSMUST00000219602]
Predicted Effect probably benign
Transcript: ENSMUST00000098162
AA Change: I292V

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000095765
Gene: ENSMUSG00000073915
AA Change: I292V

DomainStartEndE-ValueType
Pfam:7tm_4 41 317 3e-113 PFAM
Pfam:7TM_GPCR_Srsx 45 316 4.5e-7 PFAM
Pfam:7tm_1 51 301 1.5e-15 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000215533
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219042
Predicted Effect probably benign
Transcript: ENSMUST00000219602
AA Change: I292V

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca14 T C 7: 120,255,403 V930A probably benign Het
Ankrd13b T C 11: 77,471,668 R677G probably benign Het
Apc T A 18: 34,317,987 Y2611* probably null Het
Apold1 A G 6: 134,984,069 Y162C probably damaging Het
Atp6v0a4 T C 6: 38,078,802 I325V probably benign Het
Cab39 A G 1: 85,848,329 Y249C probably damaging Het
Cd22 T A 7: 30,875,900 H239L probably damaging Het
Chrna7 A G 7: 63,103,790 M327T probably damaging Het
Clock T C 5: 76,235,810 M499V probably benign Het
Clspn A G 4: 126,581,460 E1002G probably benign Het
Clta C T 4: 44,012,819 P10S probably damaging Het
Col5a3 A G 9: 20,774,559 probably null Het
Coq6 T C 12: 84,362,139 V30A probably benign Het
Csmd2 G T 4: 127,988,128 R20L probably benign Het
D430041D05Rik A T 2: 104,208,183 V1547D probably damaging Het
Dapk1 C T 13: 60,718,047 P153S probably benign Het
Dock2 T A 11: 34,239,536 Y1545F probably damaging Het
Dpp6 G T 5: 27,634,548 G354C probably damaging Het
Dyrk1b T C 7: 28,182,431 L105P probably damaging Het
Epor A G 9: 21,961,859 S86P probably benign Het
Fam166b T C 4: 43,427,574 H250R possibly damaging Het
Gale C A 4: 135,967,837 S341* probably null Het
Galnt4 T A 10: 99,109,493 V360E probably damaging Het
Gart A T 16: 91,622,945 C24* probably null Het
Gcnt2 G T 13: 40,887,490 V42L probably benign Het
Herc6 A G 6: 57,659,713 I805V probably benign Het
Ints12 T A 3: 133,098,453 I67N probably benign Het
Irx1 C A 13: 71,960,113 R150L probably damaging Het
Kif26b A G 1: 178,530,459 Y45C unknown Het
Krt35 T C 11: 100,094,008 T275A probably damaging Het
Laptm5 G T 4: 130,916,005 probably benign Het
Lin7a T C 10: 107,412,166 S111P unknown Het
Med27 A G 2: 29,524,458 D159G probably damaging Het
Msh2 A G 17: 87,708,578 K546R probably damaging Het
Myo1a A T 10: 127,720,151 probably null Het
Myo1c T C 11: 75,668,193 F604L probably damaging Het
Myrip A G 9: 120,464,784 K782E probably damaging Het
Ndc80 T C 17: 71,521,068 D88G probably damaging Het
Nrxn2 A G 19: 6,455,252 D375G probably damaging Het
Olfr1380 T C 11: 49,564,718 S266P probably damaging Het
Padi3 T C 4: 140,798,111 H187R probably damaging Het
Pcdhgb1 A T 18: 37,681,557 N367I probably damaging Het
Pdrg1 T C 2: 153,012,390 I77V probably benign Het
Pfas T C 11: 68,991,069 E930G probably benign Het
Pik3cb C T 9: 99,061,764 R662Q probably benign Het
Pla2g4e T G 2: 120,186,382 H226P possibly damaging Het
Plxnd1 A T 6: 115,994,276 V177E probably damaging Het
Prmt7 A G 8: 106,250,329 S558G possibly damaging Het
Pspc1 A C 14: 56,777,789 probably null Het
Rilp T C 11: 75,512,760 S343P probably benign Het
Ror1 A G 4: 100,407,910 M194V probably damaging Het
Rsu1 T C 2: 13,170,004 Y225C probably damaging Het
Rundc1 A G 11: 101,433,926 N486S probably damaging Het
Sema6d T A 2: 124,654,231 I65N probably damaging Het
Slc5a11 A G 7: 123,258,378 E230G probably benign Het
Spint1 T C 2: 119,246,460 S342P probably damaging Het
Stard3nl A G 13: 19,367,753 S214P probably damaging Het
Tcp10a A C 17: 7,336,924 T271P probably damaging Het
Tie1 A G 4: 118,472,634 Y1091H probably benign Het
Tlr12 T C 4: 128,617,332 Y375C probably benign Het
Tmem107 T A 11: 69,071,448 M77K probably damaging Het
Tns2 C T 15: 102,108,934 R281C probably damaging Het
Tns3 T C 11: 8,531,747 K202E probably damaging Het
Tspoap1 C T 11: 87,779,521 P1634L probably damaging Het
Ttc7b G A 12: 100,500,117 R79C probably damaging Het
Ush2a A G 1: 188,911,647 N4402S probably benign Het
Vmn2r13 A T 5: 109,156,456 I703N probably damaging Het
Xrcc4 A G 13: 90,062,007 probably null Het
Zp3 A T 5: 135,984,235 K168* probably null Het
Other mutations in Olfr676
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02034:Olfr676 APN 7 105035390 missense probably benign
IGL02244:Olfr676 APN 7 105035945 missense probably damaging 1.00
IGL03493:Olfr676 APN 7 105035944 missense probably damaging 1.00
R1181:Olfr676 UTSW 7 105035814 missense probably damaging 1.00
R1223:Olfr676 UTSW 7 105035566 missense probably benign 0.01
R1460:Olfr676 UTSW 7 105035708 missense possibly damaging 0.80
R1768:Olfr676 UTSW 7 105035950 missense probably benign 0.00
R2256:Olfr676 UTSW 7 105035819 missense probably benign 0.00
R2257:Olfr676 UTSW 7 105035819 missense probably benign 0.00
R3846:Olfr676 UTSW 7 105035689 missense probably benign 0.40
R4486:Olfr676 UTSW 7 105035303 missense probably benign 0.00
R4488:Olfr676 UTSW 7 105035303 missense probably benign 0.00
R4489:Olfr676 UTSW 7 105035303 missense probably benign 0.00
R4598:Olfr676 UTSW 7 105036073 missense probably benign 0.19
R4701:Olfr676 UTSW 7 105035591 missense probably damaging 1.00
R4855:Olfr676 UTSW 7 105035651 missense probably damaging 0.99
R5083:Olfr676 UTSW 7 105035411 missense probably damaging 1.00
R5743:Olfr676 UTSW 7 105036156 unclassified probably null
R5798:Olfr676 UTSW 7 105036137 missense probably benign 0.00
R6279:Olfr676 UTSW 7 105035671 missense probably benign 0.25
R6300:Olfr676 UTSW 7 105035671 missense probably benign 0.25
R7400:Olfr676 UTSW 7 105035210 missense probably benign
R7672:Olfr676 UTSW 7 105035543 missense probably damaging 1.00
R7698:Olfr676 UTSW 7 105035907 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- GCTAGGATCTTATATGCCGTCTTTC -3'
(R):5'- AGCTGCTTTCTGATCCACTG -3'

Sequencing Primer
(F):5'- CATCTTCCTTCTCAAGATGCTCG -3'
(R):5'- GCTTTCTGATCCACTGTTACATTG -3'
Posted On2015-09-25