Mutagenetix > Incidental Mutation

Incidental Mutation 'R4599:Epor'

345444

Institutional Source

Beutler Lab

Gene Symbol

Epor

Ensembl Gene

ENSMUSG00000006235

Gene Name

erythropoietin receptor

Synonyms

MMRRC Submission

041815-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R4599 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

21958897-21963506 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 21961859 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Proline at position 86 (S86P)

Ref Sequence

ENSEMBL: ENSMUSP00000006397 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000006397] [ENSMUST00000053583] [ENSMUST00000213181]

AlphaFold

P14753

Predicted Effect

probably benign
Transcript: ENSMUST00000006397
AA Change: S86P

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000006397
Gene: ENSMUSG00000006235
AA Change: S86P

Domain	Start	End	E-Value	Type
Pfam:EpoR_lig-bind	37	139	9.1e-30	PFAM
FN3	144	227	2.48e-6	SMART
transmembrane domain	250	272	N/A	INTRINSIC
low complexity region	434	451	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000053583

SMART Domains

Protein: ENSMUSP00000060331
Gene: ENSMUSG00000051238

Domain	Start	End	E-Value	Type
low complexity region	21	33	N/A	INTRINSIC
low complexity region	40	52	N/A	INTRINSIC
Blast:AAA	53	189	3e-34	BLAST

Predicted Effect

probably benign
Transcript: ENSMUST00000213181
AA Change: S15P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.4%
20x: 95.4%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the erythropoietin receptor which is a member of the cytokine receptor family. Upon erythropoietin binding, this receptor activates Jak2 tyrosine kinase which activates different intracellular pathways including: Ras/MAP kinase, phosphatidylinositol 3-kinase and STAT transcription factors. The stimulated erythropoietin receptor appears to have a role in erythroid cell survival. Defects in the erythropoietin receptor may produce erythroleukemia and familial erythrocytosis. Dysregulation of this gene may affect the growth of certain tumors. Alternate splicing results in multiple transcript variants.[provided by RefSeq, May 2010]
PHENOTYPE: Mutations in this locus affect erythropoiesis. Targeted null mutants die at embryonic day 11-12.5 with severe anemia. Mutants with truncated alleles are viable with mild changes in erythropoiesis. A human mutation replacement allele produces polycythemia. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 69 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca14	T	C	7: 120,255,403	V930A	probably benign	Het
Ankrd13b	T	C	11: 77,471,668	R677G	probably benign	Het
Apc	T	A	18: 34,317,987	Y2611*	probably null	Het
Apold1	A	G	6: 134,984,069	Y162C	probably damaging	Het
Atp6v0a4	T	C	6: 38,078,802	I325V	probably benign	Het
Cab39	A	G	1: 85,848,329	Y249C	probably damaging	Het
Cd22	T	A	7: 30,875,900	H239L	probably damaging	Het
Chrna7	A	G	7: 63,103,790	M327T	probably damaging	Het
Clock	T	C	5: 76,235,810	M499V	probably benign	Het
Clspn	A	G	4: 126,581,460	E1002G	probably benign	Het
Clta	C	T	4: 44,012,819	P10S	probably damaging	Het
Col5a3	A	G	9: 20,774,559		probably null	Het
Coq6	T	C	12: 84,362,139	V30A	probably benign	Het
Csmd2	G	T	4: 127,988,128	R20L	probably benign	Het
D430041D05Rik	A	T	2: 104,208,183	V1547D	probably damaging	Het
Dapk1	C	T	13: 60,718,047	P153S	probably benign	Het
Dock2	T	A	11: 34,239,536	Y1545F	probably damaging	Het
Dpp6	G	T	5: 27,634,548	G354C	probably damaging	Het
Dyrk1b	T	C	7: 28,182,431	L105P	probably damaging	Het
Fam166b	T	C	4: 43,427,574	H250R	possibly damaging	Het
Gale	C	A	4: 135,967,837	S341*	probably null	Het
Galnt4	T	A	10: 99,109,493	V360E	probably damaging	Het
Gart	A	T	16: 91,622,945	C24*	probably null	Het
Gcnt2	G	T	13: 40,887,490	V42L	probably benign	Het
Herc6	A	G	6: 57,659,713	I805V	probably benign	Het
Ints12	T	A	3: 133,098,453	I67N	probably benign	Het
Irx1	C	A	13: 71,960,113	R150L	probably damaging	Het
Kif26b	A	G	1: 178,530,459	Y45C	unknown	Het
Krt35	T	C	11: 100,094,008	T275A	probably damaging	Het
Laptm5	G	T	4: 130,916,005		probably benign	Het
Lin7a	T	C	10: 107,412,166	S111P	unknown	Het
Med27	A	G	2: 29,524,458	D159G	probably damaging	Het
Msh2	A	G	17: 87,708,578	K546R	probably damaging	Het
Myo1a	A	T	10: 127,720,151		probably null	Het
Myo1c	T	C	11: 75,668,193	F604L	probably damaging	Het
Myrip	A	G	9: 120,464,784	K782E	probably damaging	Het
Ndc80	T	C	17: 71,521,068	D88G	probably damaging	Het
Nrxn2	A	G	19: 6,455,252	D375G	probably damaging	Het
Olfr1380	T	C	11: 49,564,718	S266P	probably damaging	Het
Olfr676	A	G	7: 105,036,073	I292V	probably benign	Het
Padi3	T	C	4: 140,798,111	H187R	probably damaging	Het
Pcdhgb1	A	T	18: 37,681,557	N367I	probably damaging	Het
Pdrg1	T	C	2: 153,012,390	I77V	probably benign	Het
Pfas	T	C	11: 68,991,069	E930G	probably benign	Het
Pik3cb	C	T	9: 99,061,764	R662Q	probably benign	Het
Pla2g4e	T	G	2: 120,186,382	H226P	possibly damaging	Het
Plxnd1	A	T	6: 115,994,276	V177E	probably damaging	Het
Prmt7	A	G	8: 106,250,329	S558G	possibly damaging	Het
Pspc1	A	C	14: 56,777,789		probably null	Het
Rilp	T	C	11: 75,512,760	S343P	probably benign	Het
Ror1	A	G	4: 100,407,910	M194V	probably damaging	Het
Rsu1	T	C	2: 13,170,004	Y225C	probably damaging	Het
Rundc1	A	G	11: 101,433,926	N486S	probably damaging	Het
Sema6d	T	A	2: 124,654,231	I65N	probably damaging	Het
Slc5a11	A	G	7: 123,258,378	E230G	probably benign	Het
Spint1	T	C	2: 119,246,460	S342P	probably damaging	Het
Stard3nl	A	G	13: 19,367,753	S214P	probably damaging	Het
Tcp10a	A	C	17: 7,336,924	T271P	probably damaging	Het
Tie1	A	G	4: 118,472,634	Y1091H	probably benign	Het
Tlr12	T	C	4: 128,617,332	Y375C	probably benign	Het
Tmem107	T	A	11: 69,071,448	M77K	probably damaging	Het
Tns2	C	T	15: 102,108,934	R281C	probably damaging	Het
Tns3	T	C	11: 8,531,747	K202E	probably damaging	Het
Tspoap1	C	T	11: 87,779,521	P1634L	probably damaging	Het
Ttc7b	G	A	12: 100,500,117	R79C	probably damaging	Het
Ush2a	A	G	1: 188,911,647	N4402S	probably benign	Het
Vmn2r13	A	T	5: 109,156,456	I703N	probably damaging	Het
Xrcc4	A	G	13: 90,062,007		probably null	Het
Zp3	A	T	5: 135,984,235	K168*	probably null	Het

Other mutations in Epor

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00813:Epor	APN	9	21960591	missense	possibly damaging	0.50
IGL01377:Epor	APN	9	21959297	missense	probably damaging	1.00
IGL01400:Epor	APN	9	21959439	splice site	probably null
IGL01462:Epor	APN	9	21959456	missense	probably damaging	1.00
R1741:Epor	UTSW	9	21959771	missense	probably damaging	1.00
R1983:Epor	UTSW	9	21959400	missense	probably benign	0.00
R2414:Epor	UTSW	9	21959489	missense	probably damaging	1.00
R2655:Epor	UTSW	9	21960720	missense	probably damaging	1.00
R2879:Epor	UTSW	9	21959640	missense	probably damaging	1.00
R4598:Epor	UTSW	9	21961859	missense	probably benign	0.00
R5987:Epor	UTSW	9	21962276	missense	possibly damaging	0.83
R6462:Epor	UTSW	9	21959255	missense	probably benign	0.05
R7182:Epor	UTSW	9	21963329	missense	probably benign	0.01
R7413:Epor	UTSW	9	21963480	unclassified	probably benign
R8717:Epor	UTSW	9	21959445	missense	probably benign	0.00
R9053:Epor	UTSW	9	21959359	missense	probably benign	0.28
R9108:Epor	UTSW	9	21959579	missense	probably damaging	1.00
R9494:Epor	UTSW	9	21959226	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TGAAATGGATCCTGTAGGCGG -3'
(R):5'- CAATGGACTCAGGTATTACGTTG -3'

Sequencing Primer
(F):5'- CACCCCATCGATGTCGC -3'
(R):5'- CGTTGGAATTAGGGCACTACCATC -3'

Posted On

2015-09-25