Mutagenetix > Incidental Mutation

Incidental Mutation 'R4599:Pfas'

345454

Institutional Source

Beutler Lab

Gene Symbol

Pfas

Ensembl Gene

ENSMUSG00000020899

Gene Name

phosphoribosylformylglycinamidine synthase (FGAR amidotransferase)

Synonyms

4432409B16Rik, Sofa

MMRRC Submission

041815-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R4599 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

68985697-69008460 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 68991069 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glutamic Acid to Glycine at position 930 (E930G)

Ref Sequence

ENSEMBL: ENSMUSP00000021282 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000021282]

AlphaFold

Q5SUR0

Predicted Effect

probably benign
Transcript: ENSMUST00000021282
AA Change: E930G

PolyPhen 2 Score 0.154 (Sensitivity: 0.92; Specificity: 0.87)

SMART Domains

Protein: ENSMUSP00000021282
Gene: ENSMUSG00000020899
AA Change: E930G

Domain	Start	End	E-Value	Type
Pfam:AIRS_C	444	603	1.7e-21	PFAM
low complexity region	615	632	N/A	INTRINSIC
low complexity region	786	798	N/A	INTRINSIC
Pfam:AIRS_C	853	988	3e-11	PFAM
GATase_5	1061	1332	8.38e-133	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000122573

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000146490

Predicted Effect

probably benign
Transcript: ENSMUST00000149703

SMART Domains

Protein: ENSMUSP00000133984
Gene: ENSMUSG00000020899

Domain	Start	End	E-Value	Type
Pfam:AIRS_C	3	110	4e-12	PFAM

Predicted Effect

unknown
Transcript: ENSMUST00000152964
AA Change: E34G

SMART Domains

Protein: ENSMUSP00000121808
Gene: ENSMUSG00000020899
AA Change: E34G

Domain	Start	End	E-Value	Type
Pfam:AIRS_C	2	94	1.6e-12	PFAM
GATase_5	166	468	6.88e-120	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000172915

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000173410

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000174986

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.4%
20x: 95.4%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Purines are necessary for many cellular processes, including DNA replication, transcription, and energy metabolism. Ten enzymatic steps are required to synthesize inosine monophosphate (IMP) in the de novo pathway of purine biosynthesis. The enzyme encoded by this gene catalyzes the fourth step of IMP biosynthesis. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice heterozygous for spontaneous or ENU-induced mutations exhibit craniofacial abnormalities, most notably a domed cranium and short snout, variable white belly spots and white tail tips, and a range of eye defects including microphthalmia and anophthalmia. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 69 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca14	T	C	7: 120,255,403	V930A	probably benign	Het
Ankrd13b	T	C	11: 77,471,668	R677G	probably benign	Het
Apc	T	A	18: 34,317,987	Y2611*	probably null	Het
Apold1	A	G	6: 134,984,069	Y162C	probably damaging	Het
Atp6v0a4	T	C	6: 38,078,802	I325V	probably benign	Het
Cab39	A	G	1: 85,848,329	Y249C	probably damaging	Het
Cd22	T	A	7: 30,875,900	H239L	probably damaging	Het
Chrna7	A	G	7: 63,103,790	M327T	probably damaging	Het
Clock	T	C	5: 76,235,810	M499V	probably benign	Het
Clspn	A	G	4: 126,581,460	E1002G	probably benign	Het
Clta	C	T	4: 44,012,819	P10S	probably damaging	Het
Col5a3	A	G	9: 20,774,559		probably null	Het
Coq6	T	C	12: 84,362,139	V30A	probably benign	Het
Csmd2	G	T	4: 127,988,128	R20L	probably benign	Het
D430041D05Rik	A	T	2: 104,208,183	V1547D	probably damaging	Het
Dapk1	C	T	13: 60,718,047	P153S	probably benign	Het
Dock2	T	A	11: 34,239,536	Y1545F	probably damaging	Het
Dpp6	G	T	5: 27,634,548	G354C	probably damaging	Het
Dyrk1b	T	C	7: 28,182,431	L105P	probably damaging	Het
Epor	A	G	9: 21,961,859	S86P	probably benign	Het
Fam166b	T	C	4: 43,427,574	H250R	possibly damaging	Het
Gale	C	A	4: 135,967,837	S341*	probably null	Het
Galnt4	T	A	10: 99,109,493	V360E	probably damaging	Het
Gart	A	T	16: 91,622,945	C24*	probably null	Het
Gcnt2	G	T	13: 40,887,490	V42L	probably benign	Het
Herc6	A	G	6: 57,659,713	I805V	probably benign	Het
Ints12	T	A	3: 133,098,453	I67N	probably benign	Het
Irx1	C	A	13: 71,960,113	R150L	probably damaging	Het
Kif26b	A	G	1: 178,530,459	Y45C	unknown	Het
Krt35	T	C	11: 100,094,008	T275A	probably damaging	Het
Laptm5	G	T	4: 130,916,005		probably benign	Het
Lin7a	T	C	10: 107,412,166	S111P	unknown	Het
Med27	A	G	2: 29,524,458	D159G	probably damaging	Het
Msh2	A	G	17: 87,708,578	K546R	probably damaging	Het
Myo1a	A	T	10: 127,720,151		probably null	Het
Myo1c	T	C	11: 75,668,193	F604L	probably damaging	Het
Myrip	A	G	9: 120,464,784	K782E	probably damaging	Het
Ndc80	T	C	17: 71,521,068	D88G	probably damaging	Het
Nrxn2	A	G	19: 6,455,252	D375G	probably damaging	Het
Olfr1380	T	C	11: 49,564,718	S266P	probably damaging	Het
Olfr676	A	G	7: 105,036,073	I292V	probably benign	Het
Padi3	T	C	4: 140,798,111	H187R	probably damaging	Het
Pcdhgb1	A	T	18: 37,681,557	N367I	probably damaging	Het
Pdrg1	T	C	2: 153,012,390	I77V	probably benign	Het
Pik3cb	C	T	9: 99,061,764	R662Q	probably benign	Het
Pla2g4e	T	G	2: 120,186,382	H226P	possibly damaging	Het
Plxnd1	A	T	6: 115,994,276	V177E	probably damaging	Het
Prmt7	A	G	8: 106,250,329	S558G	possibly damaging	Het
Pspc1	A	C	14: 56,777,789		probably null	Het
Rilp	T	C	11: 75,512,760	S343P	probably benign	Het
Ror1	A	G	4: 100,407,910	M194V	probably damaging	Het
Rsu1	T	C	2: 13,170,004	Y225C	probably damaging	Het
Rundc1	A	G	11: 101,433,926	N486S	probably damaging	Het
Sema6d	T	A	2: 124,654,231	I65N	probably damaging	Het
Slc5a11	A	G	7: 123,258,378	E230G	probably benign	Het
Spint1	T	C	2: 119,246,460	S342P	probably damaging	Het
Stard3nl	A	G	13: 19,367,753	S214P	probably damaging	Het
Tcp10a	A	C	17: 7,336,924	T271P	probably damaging	Het
Tie1	A	G	4: 118,472,634	Y1091H	probably benign	Het
Tlr12	T	C	4: 128,617,332	Y375C	probably benign	Het
Tmem107	T	A	11: 69,071,448	M77K	probably damaging	Het
Tns2	C	T	15: 102,108,934	R281C	probably damaging	Het
Tns3	T	C	11: 8,531,747	K202E	probably damaging	Het
Tspoap1	C	T	11: 87,779,521	P1634L	probably damaging	Het
Ttc7b	G	A	12: 100,500,117	R79C	probably damaging	Het
Ush2a	A	G	1: 188,911,647	N4402S	probably benign	Het
Vmn2r13	A	T	5: 109,156,456	I703N	probably damaging	Het
Xrcc4	A	G	13: 90,062,007		probably null	Het
Zp3	A	T	5: 135,984,235	K168*	probably null	Het

Other mutations in Pfas

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00909:Pfas	APN	11	69003814	nonsense	probably null
IGL01287:Pfas	APN	11	69001260	missense	probably benign	0.09
IGL01712:Pfas	APN	11	68991060	missense	probably benign	0.34
IGL02019:Pfas	APN	11	68993463	unclassified	probably benign
IGL02053:Pfas	APN	11	68992953	missense	probably damaging	1.00
IGL02718:Pfas	APN	11	69000145	splice site	probably benign
IGL02801:Pfas	APN	11	68988277	unclassified	probably benign
Surf	UTSW	11	68988021	missense	probably damaging	1.00
PIT4812001:Pfas	UTSW	11	68990036	missense
R0037:Pfas	UTSW	11	69000036	missense	probably damaging	1.00
R0046:Pfas	UTSW	11	68990467	missense	probably benign
R0046:Pfas	UTSW	11	68990467	missense	probably benign
R0408:Pfas	UTSW	11	69001105	critical splice donor site	probably null
R0532:Pfas	UTSW	11	69002629	splice site	probably benign
R0707:Pfas	UTSW	11	68998037	missense	probably benign	0.00
R0783:Pfas	UTSW	11	69000521	missense	probably damaging	1.00
R0946:Pfas	UTSW	11	68993295	critical splice donor site	probably null
R0946:Pfas	UTSW	11	68990747	splice site	probably null
R1470:Pfas	UTSW	11	68991359	missense	probably benign
R1470:Pfas	UTSW	11	68991359	missense	probably benign
R1507:Pfas	UTSW	11	68990034	missense	probably benign	0.06
R1699:Pfas	UTSW	11	68998046	critical splice acceptor site	probably null
R1870:Pfas	UTSW	11	68991969	missense	probably damaging	1.00
R1871:Pfas	UTSW	11	68991969	missense	probably damaging	1.00
R1959:Pfas	UTSW	11	68994284	missense	probably damaging	1.00
R2026:Pfas	UTSW	11	68993957	missense	probably damaging	1.00
R2180:Pfas	UTSW	11	68992187	missense	possibly damaging	0.92
R3808:Pfas	UTSW	11	68989953	intron	probably benign
R3809:Pfas	UTSW	11	68989953	intron	probably benign
R3872:Pfas	UTSW	11	69000263	missense	probably damaging	1.00
R3906:Pfas	UTSW	11	68988286	unclassified	probably benign
R4092:Pfas	UTSW	11	68993949	missense	probably benign
R4437:Pfas	UTSW	11	68988417	missense	probably damaging	1.00
R4763:Pfas	UTSW	11	68990194	missense	possibly damaging	0.81
R5116:Pfas	UTSW	11	68990990	intron	probably benign
R5310:Pfas	UTSW	11	68988021	missense	probably damaging	1.00
R5328:Pfas	UTSW	11	68988592	missense	probably damaging	1.00
R5351:Pfas	UTSW	11	68991391	missense	probably damaging	1.00
R5427:Pfas	UTSW	11	69001153	missense	possibly damaging	0.90
R5533:Pfas	UTSW	11	68991470	missense	probably benign	0.02
R5602:Pfas	UTSW	11	68991045	missense	probably benign	0.05
R5637:Pfas	UTSW	11	68993323	missense	probably damaging	1.00
R5645:Pfas	UTSW	11	68991132	missense	probably damaging	1.00
R6149:Pfas	UTSW	11	68991945	missense	probably benign	0.07
R6295:Pfas	UTSW	11	68997999	missense	probably benign	0.36
R6305:Pfas	UTSW	11	69001197	missense	possibly damaging	0.51
R6387:Pfas	UTSW	11	69000465	missense	probably damaging	1.00
R6425:Pfas	UTSW	11	68991071	missense	probably benign	0.17
R6523:Pfas	UTSW	11	68990457	missense	probably benign
R6914:Pfas	UTSW	11	68992181	missense	probably benign	0.01
R6915:Pfas	UTSW	11	68992181	missense	probably benign	0.01
R6945:Pfas	UTSW	11	69000530	missense	probably benign
R6957:Pfas	UTSW	11	68993883	missense	probably benign	0.14
R7025:Pfas	UTSW	11	68990760	missense	probably benign	0.01
R7257:Pfas	UTSW	11	68992959	missense	probably damaging	1.00
R7386:Pfas	UTSW	11	69003774	missense	probably benign
R7424:Pfas	UTSW	11	69000092	missense	probably damaging	1.00
R7459:Pfas	UTSW	11	68988655	missense
R7593:Pfas	UTSW	11	68991095	missense
R7731:Pfas	UTSW	11	69000045	missense	probably damaging	1.00
R8103:Pfas	UTSW	11	68992293	missense	probably damaging	0.98
R8248:Pfas	UTSW	11	69000263	missense	probably damaging	1.00
R8804:Pfas	UTSW	11	68991082	missense
R8853:Pfas	UTSW	11	68992918	missense	probably damaging	1.00
R9032:Pfas	UTSW	11	68988595	missense
R9050:Pfas	UTSW	11	68991741	missense	probably benign	0.01
R9283:Pfas	UTSW	11	68993882	missense	probably damaging	1.00
R9644:Pfas	UTSW	11	68992716	missense	probably benign	0.23
Z1176:Pfas	UTSW	11	68990070	missense
Z1176:Pfas	UTSW	11	69002487	missense	probably damaging	1.00
Z1177:Pfas	UTSW	11	68990225	missense	probably damaging	1.00
Z1177:Pfas	UTSW	11	69002493	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- TGCACCAGGGACTATGAGAG -3'
(R):5'- AAGTGAGTGATGTGCCTTCAG -3'

Sequencing Primer
(F):5'- CCAGGGACTATGAGAGGTCGTAG -3'
(R):5'- AAACCCTTCTCTCCCGTGAGTG -3'

Posted On

2015-09-25