Incidental Mutation 'R4599:Pfas'
ID 345454
Institutional Source Beutler Lab
Gene Symbol Pfas
Ensembl Gene ENSMUSG00000020899
Gene Name phosphoribosylformylglycinamidine synthase (FGAR amidotransferase)
Synonyms 4432409B16Rik, Sofa
MMRRC Submission 041815-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R4599 (G1)
Quality Score 225
Status Not validated
Chromosome 11
Chromosomal Location 68876527-68899286 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 68881895 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Glycine at position 930 (E930G)
Ref Sequence ENSEMBL: ENSMUSP00000021282 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021282]
AlphaFold Q5SUR0
Predicted Effect probably benign
Transcript: ENSMUST00000021282
AA Change: E930G

PolyPhen 2 Score 0.154 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000021282
Gene: ENSMUSG00000020899
AA Change: E930G

DomainStartEndE-ValueType
Pfam:AIRS_C 444 603 1.7e-21 PFAM
low complexity region 615 632 N/A INTRINSIC
low complexity region 786 798 N/A INTRINSIC
Pfam:AIRS_C 853 988 3e-11 PFAM
GATase_5 1061 1332 8.38e-133 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000122573
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146490
Predicted Effect probably benign
Transcript: ENSMUST00000149703
SMART Domains Protein: ENSMUSP00000133984
Gene: ENSMUSG00000020899

DomainStartEndE-ValueType
Pfam:AIRS_C 3 110 4e-12 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000152964
AA Change: E34G
SMART Domains Protein: ENSMUSP00000121808
Gene: ENSMUSG00000020899
AA Change: E34G

DomainStartEndE-ValueType
Pfam:AIRS_C 2 94 1.6e-12 PFAM
GATase_5 166 468 6.88e-120 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000172915
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173410
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174986
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Purines are necessary for many cellular processes, including DNA replication, transcription, and energy metabolism. Ten enzymatic steps are required to synthesize inosine monophosphate (IMP) in the de novo pathway of purine biosynthesis. The enzyme encoded by this gene catalyzes the fourth step of IMP biosynthesis. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice heterozygous for spontaneous or ENU-induced mutations exhibit craniofacial abnormalities, most notably a domed cranium and short snout, variable white belly spots and white tail tips, and a range of eye defects including microphthalmia and anophthalmia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca14 T C 7: 119,854,626 (GRCm39) V930A probably benign Het
Ankrd13b T C 11: 77,362,494 (GRCm39) R677G probably benign Het
Apc T A 18: 34,451,040 (GRCm39) Y2611* probably null Het
Apold1 A G 6: 134,961,032 (GRCm39) Y162C probably damaging Het
Atp6v0a4 T C 6: 38,055,737 (GRCm39) I325V probably benign Het
Cab39 A G 1: 85,776,050 (GRCm39) Y249C probably damaging Het
Cd22 T A 7: 30,575,325 (GRCm39) H239L probably damaging Het
Chrna7 A G 7: 62,753,538 (GRCm39) M327T probably damaging Het
Cimip2b T C 4: 43,427,574 (GRCm39) H250R possibly damaging Het
Clock T C 5: 76,383,657 (GRCm39) M499V probably benign Het
Clspn A G 4: 126,475,253 (GRCm39) E1002G probably benign Het
Clta C T 4: 44,012,819 (GRCm39) P10S probably damaging Het
Col5a3 A G 9: 20,685,855 (GRCm39) probably null Het
Coq6 T C 12: 84,408,913 (GRCm39) V30A probably benign Het
Csmd2 G T 4: 127,881,921 (GRCm39) R20L probably benign Het
D430041D05Rik A T 2: 104,038,528 (GRCm39) V1547D probably damaging Het
Dapk1 C T 13: 60,865,861 (GRCm39) P153S probably benign Het
Dock2 T A 11: 34,189,536 (GRCm39) Y1545F probably damaging Het
Dpp6 G T 5: 27,839,546 (GRCm39) G354C probably damaging Het
Dyrk1b T C 7: 27,881,856 (GRCm39) L105P probably damaging Het
Epor A G 9: 21,873,155 (GRCm39) S86P probably benign Het
Gale C A 4: 135,695,148 (GRCm39) S341* probably null Het
Galnt4 T A 10: 98,945,355 (GRCm39) V360E probably damaging Het
Gart A T 16: 91,419,833 (GRCm39) C24* probably null Het
Gcnt2 G T 13: 41,040,966 (GRCm39) V42L probably benign Het
Herc6 A G 6: 57,636,698 (GRCm39) I805V probably benign Het
Ints12 T A 3: 132,804,214 (GRCm39) I67N probably benign Het
Irx1 C A 13: 72,108,232 (GRCm39) R150L probably damaging Het
Kif26b A G 1: 178,358,024 (GRCm39) Y45C unknown Het
Krt35 T C 11: 99,984,834 (GRCm39) T275A probably damaging Het
Laptm5 G T 4: 130,643,316 (GRCm39) probably benign Het
Lin7a T C 10: 107,248,027 (GRCm39) S111P unknown Het
Med27 A G 2: 29,414,470 (GRCm39) D159G probably damaging Het
Msh2 A G 17: 88,016,006 (GRCm39) K546R probably damaging Het
Myo1a A T 10: 127,556,020 (GRCm39) probably null Het
Myo1c T C 11: 75,559,019 (GRCm39) F604L probably damaging Het
Myrip A G 9: 120,293,850 (GRCm39) K782E probably damaging Het
Ndc80 T C 17: 71,828,063 (GRCm39) D88G probably damaging Het
Nrxn2 A G 19: 6,505,282 (GRCm39) D375G probably damaging Het
Or2y10 T C 11: 49,455,545 (GRCm39) S266P probably damaging Het
Or52e7 A G 7: 104,685,280 (GRCm39) I292V probably benign Het
Padi3 T C 4: 140,525,422 (GRCm39) H187R probably damaging Het
Pcdhgb1 A T 18: 37,814,610 (GRCm39) N367I probably damaging Het
Pdrg1 T C 2: 152,854,310 (GRCm39) I77V probably benign Het
Pik3cb C T 9: 98,943,817 (GRCm39) R662Q probably benign Het
Pla2g4e T G 2: 120,016,863 (GRCm39) H226P possibly damaging Het
Plxnd1 A T 6: 115,971,237 (GRCm39) V177E probably damaging Het
Prmt7 A G 8: 106,976,961 (GRCm39) S558G possibly damaging Het
Pspc1 A C 14: 57,015,246 (GRCm39) probably null Het
Rilp T C 11: 75,403,586 (GRCm39) S343P probably benign Het
Ror1 A G 4: 100,265,107 (GRCm39) M194V probably damaging Het
Rsu1 T C 2: 13,174,815 (GRCm39) Y225C probably damaging Het
Rundc1 A G 11: 101,324,752 (GRCm39) N486S probably damaging Het
Sema6d T A 2: 124,496,151 (GRCm39) I65N probably damaging Het
Slc5a11 A G 7: 122,857,601 (GRCm39) E230G probably benign Het
Spint1 T C 2: 119,076,941 (GRCm39) S342P probably damaging Het
Stard3nl A G 13: 19,551,923 (GRCm39) S214P probably damaging Het
Tcp10a A C 17: 7,604,323 (GRCm39) T271P probably damaging Het
Tie1 A G 4: 118,329,831 (GRCm39) Y1091H probably benign Het
Tlr12 T C 4: 128,511,125 (GRCm39) Y375C probably benign Het
Tmem107 T A 11: 68,962,274 (GRCm39) M77K probably damaging Het
Tns2 C T 15: 102,017,369 (GRCm39) R281C probably damaging Het
Tns3 T C 11: 8,481,747 (GRCm39) K202E probably damaging Het
Tspoap1 C T 11: 87,670,347 (GRCm39) P1634L probably damaging Het
Ttc7b G A 12: 100,466,376 (GRCm39) R79C probably damaging Het
Ush2a A G 1: 188,643,844 (GRCm39) N4402S probably benign Het
Vmn2r13 A T 5: 109,304,322 (GRCm39) I703N probably damaging Het
Xrcc4 A G 13: 90,210,126 (GRCm39) probably null Het
Zp3 A T 5: 136,013,089 (GRCm39) K168* probably null Het
Other mutations in Pfas
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00909:Pfas APN 11 68,894,640 (GRCm39) nonsense probably null
IGL01287:Pfas APN 11 68,892,086 (GRCm39) missense probably benign 0.09
IGL01712:Pfas APN 11 68,881,886 (GRCm39) missense probably benign 0.34
IGL02019:Pfas APN 11 68,884,289 (GRCm39) unclassified probably benign
IGL02053:Pfas APN 11 68,883,779 (GRCm39) missense probably damaging 1.00
IGL02718:Pfas APN 11 68,890,971 (GRCm39) splice site probably benign
IGL02801:Pfas APN 11 68,879,103 (GRCm39) unclassified probably benign
Surf UTSW 11 68,878,847 (GRCm39) missense probably damaging 1.00
PIT4812001:Pfas UTSW 11 68,880,862 (GRCm39) missense
R0037:Pfas UTSW 11 68,890,862 (GRCm39) missense probably damaging 1.00
R0046:Pfas UTSW 11 68,881,293 (GRCm39) missense probably benign
R0046:Pfas UTSW 11 68,881,293 (GRCm39) missense probably benign
R0408:Pfas UTSW 11 68,891,931 (GRCm39) critical splice donor site probably null
R0532:Pfas UTSW 11 68,893,455 (GRCm39) splice site probably benign
R0707:Pfas UTSW 11 68,888,863 (GRCm39) missense probably benign 0.00
R0783:Pfas UTSW 11 68,891,347 (GRCm39) missense probably damaging 1.00
R0946:Pfas UTSW 11 68,881,573 (GRCm39) splice site probably null
R0946:Pfas UTSW 11 68,884,121 (GRCm39) critical splice donor site probably null
R1470:Pfas UTSW 11 68,882,185 (GRCm39) missense probably benign
R1470:Pfas UTSW 11 68,882,185 (GRCm39) missense probably benign
R1507:Pfas UTSW 11 68,880,860 (GRCm39) missense probably benign 0.06
R1699:Pfas UTSW 11 68,888,872 (GRCm39) critical splice acceptor site probably null
R1870:Pfas UTSW 11 68,882,795 (GRCm39) missense probably damaging 1.00
R1871:Pfas UTSW 11 68,882,795 (GRCm39) missense probably damaging 1.00
R1959:Pfas UTSW 11 68,885,110 (GRCm39) missense probably damaging 1.00
R2026:Pfas UTSW 11 68,884,783 (GRCm39) missense probably damaging 1.00
R2180:Pfas UTSW 11 68,883,013 (GRCm39) missense possibly damaging 0.92
R3808:Pfas UTSW 11 68,880,779 (GRCm39) intron probably benign
R3809:Pfas UTSW 11 68,880,779 (GRCm39) intron probably benign
R3872:Pfas UTSW 11 68,891,089 (GRCm39) missense probably damaging 1.00
R3906:Pfas UTSW 11 68,879,112 (GRCm39) unclassified probably benign
R4092:Pfas UTSW 11 68,884,775 (GRCm39) missense probably benign
R4437:Pfas UTSW 11 68,879,243 (GRCm39) missense probably damaging 1.00
R4763:Pfas UTSW 11 68,881,020 (GRCm39) missense possibly damaging 0.81
R5116:Pfas UTSW 11 68,881,816 (GRCm39) intron probably benign
R5310:Pfas UTSW 11 68,878,847 (GRCm39) missense probably damaging 1.00
R5328:Pfas UTSW 11 68,879,418 (GRCm39) missense probably damaging 1.00
R5351:Pfas UTSW 11 68,882,217 (GRCm39) missense probably damaging 1.00
R5427:Pfas UTSW 11 68,891,979 (GRCm39) missense possibly damaging 0.90
R5533:Pfas UTSW 11 68,882,296 (GRCm39) missense probably benign 0.02
R5602:Pfas UTSW 11 68,881,871 (GRCm39) missense probably benign 0.05
R5637:Pfas UTSW 11 68,884,149 (GRCm39) missense probably damaging 1.00
R5645:Pfas UTSW 11 68,881,958 (GRCm39) missense probably damaging 1.00
R6149:Pfas UTSW 11 68,882,771 (GRCm39) missense probably benign 0.07
R6295:Pfas UTSW 11 68,888,825 (GRCm39) missense probably benign 0.36
R6305:Pfas UTSW 11 68,892,023 (GRCm39) missense possibly damaging 0.51
R6387:Pfas UTSW 11 68,891,291 (GRCm39) missense probably damaging 1.00
R6425:Pfas UTSW 11 68,881,897 (GRCm39) missense probably benign 0.17
R6523:Pfas UTSW 11 68,881,283 (GRCm39) missense probably benign
R6914:Pfas UTSW 11 68,883,007 (GRCm39) missense probably benign 0.01
R6915:Pfas UTSW 11 68,883,007 (GRCm39) missense probably benign 0.01
R6945:Pfas UTSW 11 68,891,356 (GRCm39) missense probably benign
R6957:Pfas UTSW 11 68,884,709 (GRCm39) missense probably benign 0.14
R7025:Pfas UTSW 11 68,881,586 (GRCm39) missense probably benign 0.01
R7257:Pfas UTSW 11 68,883,785 (GRCm39) missense probably damaging 1.00
R7386:Pfas UTSW 11 68,894,600 (GRCm39) missense probably benign
R7424:Pfas UTSW 11 68,890,918 (GRCm39) missense probably damaging 1.00
R7459:Pfas UTSW 11 68,879,481 (GRCm39) missense
R7593:Pfas UTSW 11 68,881,921 (GRCm39) missense
R7731:Pfas UTSW 11 68,890,871 (GRCm39) missense probably damaging 1.00
R8103:Pfas UTSW 11 68,883,119 (GRCm39) missense probably damaging 0.98
R8248:Pfas UTSW 11 68,891,089 (GRCm39) missense probably damaging 1.00
R8804:Pfas UTSW 11 68,881,908 (GRCm39) missense
R8853:Pfas UTSW 11 68,883,744 (GRCm39) missense probably damaging 1.00
R9032:Pfas UTSW 11 68,879,421 (GRCm39) missense
R9050:Pfas UTSW 11 68,882,567 (GRCm39) missense probably benign 0.01
R9283:Pfas UTSW 11 68,884,708 (GRCm39) missense probably damaging 1.00
R9644:Pfas UTSW 11 68,883,542 (GRCm39) missense probably benign 0.23
Z1176:Pfas UTSW 11 68,893,313 (GRCm39) missense probably damaging 1.00
Z1176:Pfas UTSW 11 68,880,896 (GRCm39) missense
Z1177:Pfas UTSW 11 68,893,319 (GRCm39) nonsense probably null
Z1177:Pfas UTSW 11 68,881,051 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGCACCAGGGACTATGAGAG -3'
(R):5'- AAGTGAGTGATGTGCCTTCAG -3'

Sequencing Primer
(F):5'- CCAGGGACTATGAGAGGTCGTAG -3'
(R):5'- AAACCCTTCTCTCCCGTGAGTG -3'
Posted On 2015-09-25