Mutagenetix > Incidental Mutation

Incidental Mutation 'R4599:Tns2'

345471

Institutional Source

Beutler Lab

Gene Symbol

Tns2

Ensembl Gene

ENSMUSG00000037003

Gene Name

tensin 2

Synonyms

nph, nep, Tenc1

MMRRC Submission

041815-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R4599 (G1)

Quality Score

222

Status

Not validated

Chromosome

Chromosomal Location

102100413-102116401 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 102108934 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Arginine to Cysteine at position 281 (R281C)

Ref Sequence

ENSEMBL: ENSMUSP00000155830 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000046144] [ENSMUST00000169627] [ENSMUST00000228958] [ENSMUST00000229592] [ENSMUST00000230474]

AlphaFold

Q8CGB6

Predicted Effect

probably damaging
Transcript: ENSMUST00000046144
AA Change: R281C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000041087
Gene: ENSMUSG00000037003
AA Change: R281C

Domain	Start	End	E-Value	Type
C1	32	79	2.78e-9	SMART
SCOP:d1d5ra2	128	295	8e-24	SMART
PTEN_C2	297	424	6.63e-40	SMART
low complexity region	494	513	N/A	INTRINSIC
SH2	1136	1236	1.69e-16	SMART
PTB	1269	1407	6.66e-28	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000169627
AA Change: R281C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000129146
Gene: ENSMUSG00000037003
AA Change: R281C

Domain	Start	End	E-Value	Type
C1	32	79	2.78e-9	SMART
SCOP:d1d5ra2	128	295	8e-24	SMART
PTEN_C2	297	424	6.63e-40	SMART
low complexity region	494	513	N/A	INTRINSIC
SH2	1129	1229	1.69e-16	SMART
PTB	1262	1400	6.66e-28	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000228958
AA Change: R281C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000229035

Predicted Effect

probably benign
Transcript: ENSMUST00000229592

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000229908

Predicted Effect

probably damaging
Transcript: ENSMUST00000230474
AA Change: R273C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

Meta Mutation Damage Score

0.2021

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.4%
20x: 95.4%

Validation Efficiency

MGI Phenotype

Strain: 2447990
Lethality: D70-D210
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the tensin family. Tensin is a focal adhesion molecule that binds to actin filaments and participates in signaling pathways. This protein plays a role in regulating cell migration. Alternative splicing occurs at this locus and three transcript variants encoding three distinct isoforms have been identified. [provided by RefSeq, Jul 2008]
PHENOTYPE: Affected mice homozygous for a spontaneous deletion show reduced female fertility, increased blood urea nitrogen, low hematocrit, proteinuria, hypoproteinemia, hypercholesterolemia, small kidneys with a yellowish granular surface, glomerular lesions and premature death; some develop systemic edema. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 69 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca14	T	C	7: 120,255,403	V930A	probably benign	Het
Ankrd13b	T	C	11: 77,471,668	R677G	probably benign	Het
Apc	T	A	18: 34,317,987	Y2611*	probably null	Het
Apold1	A	G	6: 134,984,069	Y162C	probably damaging	Het
Atp6v0a4	T	C	6: 38,078,802	I325V	probably benign	Het
Cab39	A	G	1: 85,848,329	Y249C	probably damaging	Het
Cd22	T	A	7: 30,875,900	H239L	probably damaging	Het
Chrna7	A	G	7: 63,103,790	M327T	probably damaging	Het
Clock	T	C	5: 76,235,810	M499V	probably benign	Het
Clspn	A	G	4: 126,581,460	E1002G	probably benign	Het
Clta	C	T	4: 44,012,819	P10S	probably damaging	Het
Col5a3	A	G	9: 20,774,559		probably null	Het
Coq6	T	C	12: 84,362,139	V30A	probably benign	Het
Csmd2	G	T	4: 127,988,128	R20L	probably benign	Het
D430041D05Rik	A	T	2: 104,208,183	V1547D	probably damaging	Het
Dapk1	C	T	13: 60,718,047	P153S	probably benign	Het
Dock2	T	A	11: 34,239,536	Y1545F	probably damaging	Het
Dpp6	G	T	5: 27,634,548	G354C	probably damaging	Het
Dyrk1b	T	C	7: 28,182,431	L105P	probably damaging	Het
Epor	A	G	9: 21,961,859	S86P	probably benign	Het
Fam166b	T	C	4: 43,427,574	H250R	possibly damaging	Het
Gale	C	A	4: 135,967,837	S341*	probably null	Het
Galnt4	T	A	10: 99,109,493	V360E	probably damaging	Het
Gart	A	T	16: 91,622,945	C24*	probably null	Het
Gcnt2	G	T	13: 40,887,490	V42L	probably benign	Het
Herc6	A	G	6: 57,659,713	I805V	probably benign	Het
Ints12	T	A	3: 133,098,453	I67N	probably benign	Het
Irx1	C	A	13: 71,960,113	R150L	probably damaging	Het
Kif26b	A	G	1: 178,530,459	Y45C	unknown	Het
Krt35	T	C	11: 100,094,008	T275A	probably damaging	Het
Laptm5	G	T	4: 130,916,005		probably benign	Het
Lin7a	T	C	10: 107,412,166	S111P	unknown	Het
Med27	A	G	2: 29,524,458	D159G	probably damaging	Het
Msh2	A	G	17: 87,708,578	K546R	probably damaging	Het
Myo1a	A	T	10: 127,720,151		probably null	Het
Myo1c	T	C	11: 75,668,193	F604L	probably damaging	Het
Myrip	A	G	9: 120,464,784	K782E	probably damaging	Het
Ndc80	T	C	17: 71,521,068	D88G	probably damaging	Het
Nrxn2	A	G	19: 6,455,252	D375G	probably damaging	Het
Olfr1380	T	C	11: 49,564,718	S266P	probably damaging	Het
Olfr676	A	G	7: 105,036,073	I292V	probably benign	Het
Padi3	T	C	4: 140,798,111	H187R	probably damaging	Het
Pcdhgb1	A	T	18: 37,681,557	N367I	probably damaging	Het
Pdrg1	T	C	2: 153,012,390	I77V	probably benign	Het
Pfas	T	C	11: 68,991,069	E930G	probably benign	Het
Pik3cb	C	T	9: 99,061,764	R662Q	probably benign	Het
Pla2g4e	T	G	2: 120,186,382	H226P	possibly damaging	Het
Plxnd1	A	T	6: 115,994,276	V177E	probably damaging	Het
Prmt7	A	G	8: 106,250,329	S558G	possibly damaging	Het
Pspc1	A	C	14: 56,777,789		probably null	Het
Rilp	T	C	11: 75,512,760	S343P	probably benign	Het
Ror1	A	G	4: 100,407,910	M194V	probably damaging	Het
Rsu1	T	C	2: 13,170,004	Y225C	probably damaging	Het
Rundc1	A	G	11: 101,433,926	N486S	probably damaging	Het
Sema6d	T	A	2: 124,654,231	I65N	probably damaging	Het
Slc5a11	A	G	7: 123,258,378	E230G	probably benign	Het
Spint1	T	C	2: 119,246,460	S342P	probably damaging	Het
Stard3nl	A	G	13: 19,367,753	S214P	probably damaging	Het
Tcp10a	A	C	17: 7,336,924	T271P	probably damaging	Het
Tie1	A	G	4: 118,472,634	Y1091H	probably benign	Het
Tlr12	T	C	4: 128,617,332	Y375C	probably benign	Het
Tmem107	T	A	11: 69,071,448	M77K	probably damaging	Het
Tns3	T	C	11: 8,531,747	K202E	probably damaging	Het
Tspoap1	C	T	11: 87,779,521	P1634L	probably damaging	Het
Ttc7b	G	A	12: 100,500,117	R79C	probably damaging	Het
Ush2a	A	G	1: 188,911,647	N4402S	probably benign	Het
Vmn2r13	A	T	5: 109,156,456	I703N	probably damaging	Het
Xrcc4	A	G	13: 90,062,007		probably null	Het
Zp3	A	T	5: 135,984,235	K168*	probably null	Het

Other mutations in Tns2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01575:Tns2	APN	15	102113191	missense	probably damaging	1.00
IGL01935:Tns2	APN	15	102111634	splice site	probably null
IGL01994:Tns2	APN	15	102111379	missense	possibly damaging	0.81
IGL02025:Tns2	APN	15	102112049	nonsense	probably null
IGL02135:Tns2	APN	15	102113026	missense	probably damaging	1.00
IGL02355:Tns2	APN	15	102112290	missense	probably benign
IGL02362:Tns2	APN	15	102112290	missense	probably benign
IGL02439:Tns2	APN	15	102114543	missense	probably damaging	1.00
IGL02488:Tns2	APN	15	102112743	missense	probably benign
IGL02546:Tns2	APN	15	102110940	missense	probably damaging	1.00
IGL02616:Tns2	APN	15	102111415	missense	probably benign
IGL02628:Tns2	APN	15	102111828	missense	probably benign	0.04
IGL02658:Tns2	APN	15	102107796	splice site	probably benign
IGL03267:Tns2	APN	15	102105378	critical splice donor site	probably null
P0005:Tns2	UTSW	15	102114056	missense	probably damaging	0.98
R0586:Tns2	UTSW	15	102109585	splice site	probably benign
R0791:Tns2	UTSW	15	102108934	missense	probably damaging	1.00
R0817:Tns2	UTSW	15	102108934	missense	probably damaging	1.00
R0818:Tns2	UTSW	15	102108934	missense	probably damaging	1.00
R0819:Tns2	UTSW	15	102108934	missense	probably damaging	1.00
R0820:Tns2	UTSW	15	102108934	missense	probably damaging	1.00
R1451:Tns2	UTSW	15	102108934	missense	probably damaging	1.00
R1452:Tns2	UTSW	15	102108934	missense	probably damaging	1.00
R1453:Tns2	UTSW	15	102108934	missense	probably damaging	1.00
R1454:Tns2	UTSW	15	102108934	missense	probably damaging	1.00
R1455:Tns2	UTSW	15	102108934	missense	probably damaging	1.00
R1487:Tns2	UTSW	15	102108934	missense	probably damaging	1.00
R1510:Tns2	UTSW	15	102108934	missense	probably damaging	1.00
R1579:Tns2	UTSW	15	102111210	missense	probably damaging	1.00
R1698:Tns2	UTSW	15	102108934	missense	probably damaging	1.00
R1772:Tns2	UTSW	15	102108934	missense	probably damaging	1.00
R1779:Tns2	UTSW	15	102108934	missense	probably damaging	1.00
R1843:Tns2	UTSW	15	102113133	splice site	probably null
R1923:Tns2	UTSW	15	102108934	missense	probably damaging	1.00
R1924:Tns2	UTSW	15	102108934	missense	probably damaging	1.00
R1927:Tns2	UTSW	15	102108934	missense	probably damaging	1.00
R1980:Tns2	UTSW	15	102108934	missense	probably damaging	1.00
R2051:Tns2	UTSW	15	102108934	missense	probably damaging	1.00
R2087:Tns2	UTSW	15	102107119	missense	possibly damaging	0.70
R2100:Tns2	UTSW	15	102108934	missense	probably damaging	1.00
R2103:Tns2	UTSW	15	102112665	critical splice acceptor site	probably null
R2105:Tns2	UTSW	15	102107506	missense	probably benign	0.27
R2224:Tns2	UTSW	15	102108934	missense	probably damaging	1.00
R2225:Tns2	UTSW	15	102108934	missense	probably damaging	1.00
R2227:Tns2	UTSW	15	102108934	missense	probably damaging	1.00
R2252:Tns2	UTSW	15	102108934	missense	probably damaging	1.00
R2253:Tns2	UTSW	15	102108934	missense	probably damaging	1.00
R2290:Tns2	UTSW	15	102112023	missense	probably damaging	0.99
R2304:Tns2	UTSW	15	102108934	missense	probably damaging	1.00
R2318:Tns2	UTSW	15	102108934	missense	probably damaging	1.00
R2446:Tns2	UTSW	15	102108934	missense	probably damaging	1.00
R2447:Tns2	UTSW	15	102108934	missense	probably damaging	1.00
R2448:Tns2	UTSW	15	102108934	missense	probably damaging	1.00
R2566:Tns2	UTSW	15	102108934	missense	probably damaging	1.00
R2567:Tns2	UTSW	15	102108934	missense	probably damaging	1.00
R2897:Tns2	UTSW	15	102108934	missense	probably damaging	1.00
R2898:Tns2	UTSW	15	102108934	missense	probably damaging	1.00
R3159:Tns2	UTSW	15	102108934	missense	probably damaging	1.00
R3160:Tns2	UTSW	15	102113336	missense	possibly damaging	0.88
R3162:Tns2	UTSW	15	102113336	missense	possibly damaging	0.88
R3162:Tns2	UTSW	15	102113336	missense	possibly damaging	0.88
R3196:Tns2	UTSW	15	102108934	missense	probably damaging	1.00
R3237:Tns2	UTSW	15	102108934	missense	probably damaging	1.00
R3426:Tns2	UTSW	15	102108934	missense	probably damaging	1.00
R3427:Tns2	UTSW	15	102108934	missense	probably damaging	1.00
R3428:Tns2	UTSW	15	102108934	missense	probably damaging	1.00
R3695:Tns2	UTSW	15	102112749	missense	probably null
R3767:Tns2	UTSW	15	102108934	missense	probably damaging	1.00
R3911:Tns2	UTSW	15	102113837	critical splice donor site	probably null
R4113:Tns2	UTSW	15	102108934	missense	probably damaging	1.00
R4157:Tns2	UTSW	15	102108934	missense	probably damaging	1.00
R4394:Tns2	UTSW	15	102108934	missense	probably damaging	1.00
R4395:Tns2	UTSW	15	102108934	missense	probably damaging	1.00
R4396:Tns2	UTSW	15	102108934	missense	probably damaging	1.00
R4439:Tns2	UTSW	15	102108934	missense	probably damaging	1.00
R4441:Tns2	UTSW	15	102108934	missense	probably damaging	1.00
R4537:Tns2	UTSW	15	102108934	missense	probably damaging	1.00
R4538:Tns2	UTSW	15	102108934	missense	probably damaging	1.00
R4541:Tns2	UTSW	15	102108934	missense	probably damaging	1.00
R4600:Tns2	UTSW	15	102108934	missense	probably damaging	1.00
R4602:Tns2	UTSW	15	102108934	missense	probably damaging	1.00
R4773:Tns2	UTSW	15	102108934	missense	probably damaging	1.00
R4774:Tns2	UTSW	15	102108934	missense	probably damaging	1.00
R4775:Tns2	UTSW	15	102108934	missense	probably damaging	1.00
R4776:Tns2	UTSW	15	102108934	missense	probably damaging	1.00
R4880:Tns2	UTSW	15	102112039	missense	probably damaging	0.98
R4989:Tns2	UTSW	15	102108934	missense	probably damaging	1.00
R5014:Tns2	UTSW	15	102108934	missense	probably damaging	1.00
R5058:Tns2	UTSW	15	102107860	missense	possibly damaging	0.68
R5253:Tns2	UTSW	15	102111453	missense	probably damaging	1.00
R5336:Tns2	UTSW	15	102111229	missense	probably damaging	1.00
R5351:Tns2	UTSW	15	102108934	missense	probably damaging	1.00
R5452:Tns2	UTSW	15	102108934	missense	probably damaging	1.00
R5453:Tns2	UTSW	15	102108934	missense	probably damaging	1.00
R5629:Tns2	UTSW	15	102108934	missense	probably damaging	1.00
R5630:Tns2	UTSW	15	102108934	missense	probably damaging	1.00
R5631:Tns2	UTSW	15	102108934	missense	probably damaging	1.00
R5685:Tns2	UTSW	15	102107103	missense	probably benign	0.02
R5844:Tns2	UTSW	15	102108934	missense	probably damaging	1.00
R6048:Tns2	UTSW	15	102111411	missense	probably damaging	1.00
R6067:Tns2	UTSW	15	102108934	missense	probably damaging	1.00
R6079:Tns2	UTSW	15	102108934	missense	probably damaging	1.00
R6130:Tns2	UTSW	15	102111241	missense	probably damaging	1.00
R6136:Tns2	UTSW	15	102107030	missense	probably damaging	1.00
R6138:Tns2	UTSW	15	102108934	missense	probably damaging	1.00
R6199:Tns2	UTSW	15	102108934	missense	probably damaging	1.00
R6210:Tns2	UTSW	15	102108934	missense	probably damaging	1.00
R6426:Tns2	UTSW	15	102107037	missense	possibly damaging	0.65
R6544:Tns2	UTSW	15	102113834	missense	possibly damaging	0.93
R6594:Tns2	UTSW	15	102110559	missense	probably benign	0.00
R6596:Tns2	UTSW	15	102110559	missense	probably benign	0.00
R6734:Tns2	UTSW	15	102103116	missense	probably damaging	0.96
R7061:Tns2	UTSW	15	102104479	start codon destroyed	probably null
R7070:Tns2	UTSW	15	102104533	missense	possibly damaging	0.58
R7110:Tns2	UTSW	15	102105366	missense	probably damaging	0.99
R7410:Tns2	UTSW	15	102110526	missense	probably damaging	1.00
R7447:Tns2	UTSW	15	102110916	missense	probably damaging	1.00
R7751:Tns2	UTSW	15	102109728	missense	probably benign	0.02
R8052:Tns2	UTSW	15	102112845	missense	probably damaging	1.00
R8114:Tns2	UTSW	15	102111390	missense	probably benign	0.01
R8906:Tns2	UTSW	15	102111604	missense	probably damaging	1.00
R8964:Tns2	UTSW	15	102103118	missense	possibly damaging	0.73
R9192:Tns2	UTSW	15	102112981	missense	probably damaging	1.00
R9273:Tns2	UTSW	15	102113043	missense	probably damaging	1.00
R9307:Tns2	UTSW	15	102110561	missense	probably damaging	0.97
R9402:Tns2	UTSW	15	102113188	missense	probably damaging	0.99
R9612:Tns2	UTSW	15	102107142	missense	probably damaging	1.00
R9655:Tns2	UTSW	15	102104498	missense	probably benign	0.03
U15987:Tns2	UTSW	15	102108934	missense	probably damaging	1.00
X0009:Tns2	UTSW	15	102112465	missense	possibly damaging	0.94
X0026:Tns2	UTSW	15	102110502	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CAGAGGATCTCATGATTCCTCCTTC -3'
(R):5'- CCTGTGGAGTCTTTCTTACAAGC -3'

Sequencing Primer
(F):5'- CCTTCCCTGGGGTTTAGGTATAGAAG -3'
(R):5'- GCCAGAACGATCTAGTCTGTTTACG -3'

Posted On

2015-09-25