Incidental Mutation 'R4599:Gart'
ID 345472
Institutional Source Beutler Lab
Gene Symbol Gart
Ensembl Gene ENSMUSG00000022962
Gene Name phosphoribosylglycinamide formyltransferase
Synonyms Prgs, Gaps
MMRRC Submission 041815-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R4599 (G1)
Quality Score 225
Status Not validated
Chromosome 16
Chromosomal Location 91418074-91443840 bp(-) (GRCm39)
Type of Mutation nonsense
DNA Base Change (assembly) A to T at 91419833 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Cysteine to Stop codon at position 24 (C24*)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023684] [ENSMUST00000049244] [ENSMUST00000133731] [ENSMUST00000143058] [ENSMUST00000156713] [ENSMUST00000169982] [ENSMUST00000232289] [ENSMUST00000232640]
AlphaFold Q64737
Predicted Effect probably null
Transcript: ENSMUST00000023684
AA Change: C891*
SMART Domains Protein: ENSMUSP00000023684
Gene: ENSMUSG00000022962
AA Change: C891*

DomainStartEndE-ValueType
Pfam:GARS_N 3 104 6.4e-37 PFAM
GARS_A 105 298 4.42e-132 SMART
GARS_C 333 426 1.33e-44 SMART
Pfam:AIRS 473 593 1.2e-17 PFAM
Pfam:AIRS_C 606 777 9e-40 PFAM
Pfam:Formyl_trans_N 808 988 3.4e-68 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000049244
SMART Domains Protein: ENSMUSP00000048113
Gene: ENSMUSG00000039763

DomainStartEndE-ValueType
DnaJ 47 105 1.04e-11 SMART
low complexity region 112 123 N/A INTRINSIC
Pfam:DUF1992 203 342 4.7e-25 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000133731
SMART Domains Protein: ENSMUSP00000118526
Gene: ENSMUSG00000039763

DomainStartEndE-ValueType
DnaJ 47 84 6.65e-2 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138207
Predicted Effect probably benign
Transcript: ENSMUST00000143058
SMART Domains Protein: ENSMUSP00000120318
Gene: ENSMUSG00000039763

DomainStartEndE-ValueType
DnaJ 71 129 1.04e-11 SMART
low complexity region 136 147 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000156713
SMART Domains Protein: ENSMUSP00000119272
Gene: ENSMUSG00000022962

DomainStartEndE-ValueType
Pfam:GARS_N 3 104 1.4e-40 PFAM
GARS_A 105 298 4.42e-132 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000169982
SMART Domains Protein: ENSMUSP00000132288
Gene: ENSMUSG00000039763

DomainStartEndE-ValueType
DnaJ 71 129 1.04e-11 SMART
low complexity region 136 147 N/A INTRINSIC
Pfam:DUF1992 227 295 1.2e-24 PFAM
coiled coil region 312 342 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000232289
AA Change: C891*
Predicted Effect noncoding transcript
Transcript: ENSMUST00000232620
Predicted Effect probably benign
Transcript: ENSMUST00000232640
Predicted Effect probably null
Transcript: ENSMUST00000232643
AA Change: C24*
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a trifunctional polypeptide. It has phosphoribosylglycinamide formyltransferase, phosphoribosylglycinamide synthetase, phosphoribosylaminoimidazole synthetase activity which is required for de novo purine biosynthesis. This enzyme is highly conserved in vertebrates. Alternative splicing of this gene results in two transcript variants encoding different isoforms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca14 T C 7: 119,854,626 (GRCm39) V930A probably benign Het
Ankrd13b T C 11: 77,362,494 (GRCm39) R677G probably benign Het
Apc T A 18: 34,451,040 (GRCm39) Y2611* probably null Het
Apold1 A G 6: 134,961,032 (GRCm39) Y162C probably damaging Het
Atp6v0a4 T C 6: 38,055,737 (GRCm39) I325V probably benign Het
Cab39 A G 1: 85,776,050 (GRCm39) Y249C probably damaging Het
Cd22 T A 7: 30,575,325 (GRCm39) H239L probably damaging Het
Chrna7 A G 7: 62,753,538 (GRCm39) M327T probably damaging Het
Cimip2b T C 4: 43,427,574 (GRCm39) H250R possibly damaging Het
Clock T C 5: 76,383,657 (GRCm39) M499V probably benign Het
Clspn A G 4: 126,475,253 (GRCm39) E1002G probably benign Het
Clta C T 4: 44,012,819 (GRCm39) P10S probably damaging Het
Col5a3 A G 9: 20,685,855 (GRCm39) probably null Het
Coq6 T C 12: 84,408,913 (GRCm39) V30A probably benign Het
Csmd2 G T 4: 127,881,921 (GRCm39) R20L probably benign Het
D430041D05Rik A T 2: 104,038,528 (GRCm39) V1547D probably damaging Het
Dapk1 C T 13: 60,865,861 (GRCm39) P153S probably benign Het
Dock2 T A 11: 34,189,536 (GRCm39) Y1545F probably damaging Het
Dpp6 G T 5: 27,839,546 (GRCm39) G354C probably damaging Het
Dyrk1b T C 7: 27,881,856 (GRCm39) L105P probably damaging Het
Epor A G 9: 21,873,155 (GRCm39) S86P probably benign Het
Gale C A 4: 135,695,148 (GRCm39) S341* probably null Het
Galnt4 T A 10: 98,945,355 (GRCm39) V360E probably damaging Het
Gcnt2 G T 13: 41,040,966 (GRCm39) V42L probably benign Het
Herc6 A G 6: 57,636,698 (GRCm39) I805V probably benign Het
Ints12 T A 3: 132,804,214 (GRCm39) I67N probably benign Het
Irx1 C A 13: 72,108,232 (GRCm39) R150L probably damaging Het
Kif26b A G 1: 178,358,024 (GRCm39) Y45C unknown Het
Krt35 T C 11: 99,984,834 (GRCm39) T275A probably damaging Het
Laptm5 G T 4: 130,643,316 (GRCm39) probably benign Het
Lin7a T C 10: 107,248,027 (GRCm39) S111P unknown Het
Med27 A G 2: 29,414,470 (GRCm39) D159G probably damaging Het
Msh2 A G 17: 88,016,006 (GRCm39) K546R probably damaging Het
Myo1a A T 10: 127,556,020 (GRCm39) probably null Het
Myo1c T C 11: 75,559,019 (GRCm39) F604L probably damaging Het
Myrip A G 9: 120,293,850 (GRCm39) K782E probably damaging Het
Ndc80 T C 17: 71,828,063 (GRCm39) D88G probably damaging Het
Nrxn2 A G 19: 6,505,282 (GRCm39) D375G probably damaging Het
Or2y10 T C 11: 49,455,545 (GRCm39) S266P probably damaging Het
Or52e7 A G 7: 104,685,280 (GRCm39) I292V probably benign Het
Padi3 T C 4: 140,525,422 (GRCm39) H187R probably damaging Het
Pcdhgb1 A T 18: 37,814,610 (GRCm39) N367I probably damaging Het
Pdrg1 T C 2: 152,854,310 (GRCm39) I77V probably benign Het
Pfas T C 11: 68,881,895 (GRCm39) E930G probably benign Het
Pik3cb C T 9: 98,943,817 (GRCm39) R662Q probably benign Het
Pla2g4e T G 2: 120,016,863 (GRCm39) H226P possibly damaging Het
Plxnd1 A T 6: 115,971,237 (GRCm39) V177E probably damaging Het
Prmt7 A G 8: 106,976,961 (GRCm39) S558G possibly damaging Het
Pspc1 A C 14: 57,015,246 (GRCm39) probably null Het
Rilp T C 11: 75,403,586 (GRCm39) S343P probably benign Het
Ror1 A G 4: 100,265,107 (GRCm39) M194V probably damaging Het
Rsu1 T C 2: 13,174,815 (GRCm39) Y225C probably damaging Het
Rundc1 A G 11: 101,324,752 (GRCm39) N486S probably damaging Het
Sema6d T A 2: 124,496,151 (GRCm39) I65N probably damaging Het
Slc5a11 A G 7: 122,857,601 (GRCm39) E230G probably benign Het
Spint1 T C 2: 119,076,941 (GRCm39) S342P probably damaging Het
Stard3nl A G 13: 19,551,923 (GRCm39) S214P probably damaging Het
Tcp10a A C 17: 7,604,323 (GRCm39) T271P probably damaging Het
Tie1 A G 4: 118,329,831 (GRCm39) Y1091H probably benign Het
Tlr12 T C 4: 128,511,125 (GRCm39) Y375C probably benign Het
Tmem107 T A 11: 68,962,274 (GRCm39) M77K probably damaging Het
Tns2 C T 15: 102,017,369 (GRCm39) R281C probably damaging Het
Tns3 T C 11: 8,481,747 (GRCm39) K202E probably damaging Het
Tspoap1 C T 11: 87,670,347 (GRCm39) P1634L probably damaging Het
Ttc7b G A 12: 100,466,376 (GRCm39) R79C probably damaging Het
Ush2a A G 1: 188,643,844 (GRCm39) N4402S probably benign Het
Vmn2r13 A T 5: 109,304,322 (GRCm39) I703N probably damaging Het
Xrcc4 A G 13: 90,210,126 (GRCm39) probably null Het
Zp3 A T 5: 136,013,089 (GRCm39) K168* probably null Het
Other mutations in Gart
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00597:Gart APN 16 91,435,677 (GRCm39) missense possibly damaging 0.58
IGL00837:Gart APN 16 91,435,608 (GRCm39) unclassified probably benign
IGL01010:Gart APN 16 91,439,980 (GRCm39) nonsense probably null
IGL01064:Gart APN 16 91,419,895 (GRCm39) missense probably damaging 1.00
IGL01451:Gart APN 16 91,422,400 (GRCm39) missense probably benign
IGL02084:Gart APN 16 91,418,488 (GRCm39) missense probably benign
IGL02301:Gart APN 16 91,418,725 (GRCm39) splice site probably benign
IGL02814:Gart APN 16 91,420,345 (GRCm39) missense possibly damaging 0.58
sylvester UTSW 16 91,427,490 (GRCm39) splice site probably benign
PIT4453001:Gart UTSW 16 91,433,426 (GRCm39) missense probably damaging 1.00
R0137:Gart UTSW 16 91,422,282 (GRCm39) missense probably benign
R0197:Gart UTSW 16 91,420,291 (GRCm39) missense possibly damaging 0.95
R0321:Gart UTSW 16 91,419,925 (GRCm39) unclassified probably benign
R0322:Gart UTSW 16 91,419,925 (GRCm39) unclassified probably benign
R0398:Gart UTSW 16 91,436,337 (GRCm39) missense probably damaging 1.00
R0410:Gart UTSW 16 91,438,215 (GRCm39) missense probably damaging 1.00
R0496:Gart UTSW 16 91,419,925 (GRCm39) unclassified probably benign
R0620:Gart UTSW 16 91,427,490 (GRCm39) splice site probably benign
R0628:Gart UTSW 16 91,430,790 (GRCm39) missense probably benign 0.01
R0883:Gart UTSW 16 91,420,291 (GRCm39) missense possibly damaging 0.95
R1346:Gart UTSW 16 91,425,070 (GRCm39) splice site probably null
R1490:Gart UTSW 16 91,421,232 (GRCm39) missense probably damaging 1.00
R1686:Gart UTSW 16 91,422,237 (GRCm39) missense probably damaging 1.00
R1751:Gart UTSW 16 91,439,837 (GRCm39) splice site probably benign
R1917:Gart UTSW 16 91,425,037 (GRCm39) missense probably damaging 1.00
R2144:Gart UTSW 16 91,426,969 (GRCm39) missense probably damaging 1.00
R2421:Gart UTSW 16 91,439,928 (GRCm39) splice site probably null
R4305:Gart UTSW 16 91,430,880 (GRCm39) missense possibly damaging 0.48
R4377:Gart UTSW 16 91,430,982 (GRCm39) missense probably benign 0.31
R4619:Gart UTSW 16 91,422,321 (GRCm39) missense probably damaging 1.00
R4620:Gart UTSW 16 91,422,321 (GRCm39) missense probably damaging 1.00
R5112:Gart UTSW 16 91,430,933 (GRCm39) missense probably benign 0.02
R5902:Gart UTSW 16 91,425,415 (GRCm39) missense probably damaging 1.00
R5975:Gart UTSW 16 91,421,224 (GRCm39) missense probably damaging 1.00
R6736:Gart UTSW 16 91,432,995 (GRCm39) missense probably benign 0.21
R7041:Gart UTSW 16 91,440,031 (GRCm39) start gained probably benign
R7150:Gart UTSW 16 91,425,351 (GRCm39) missense possibly damaging 0.69
R7320:Gart UTSW 16 91,418,569 (GRCm39) missense probably benign 0.00
R7709:Gart UTSW 16 91,419,853 (GRCm39) missense possibly damaging 0.92
R7748:Gart UTSW 16 91,427,540 (GRCm39) missense possibly damaging 0.66
R7911:Gart UTSW 16 91,435,672 (GRCm39) missense probably benign 0.23
R8066:Gart UTSW 16 91,436,335 (GRCm39) missense probably benign
R8209:Gart UTSW 16 91,425,041 (GRCm39) missense possibly damaging 0.78
R8824:Gart UTSW 16 91,427,591 (GRCm39) missense possibly damaging 0.64
R8840:Gart UTSW 16 91,433,010 (GRCm39) missense probably benign 0.02
R9046:Gart UTSW 16 91,418,561 (GRCm39) missense probably damaging 1.00
R9178:Gart UTSW 16 91,430,904 (GRCm39) missense possibly damaging 0.87
R9514:Gart UTSW 16 91,427,596 (GRCm39) missense probably benign 0.03
R9753:Gart UTSW 16 91,430,949 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCTTGCAGTAATGGAGCCAGG -3'
(R):5'- ATGCTTGTGAAATCTTGGGACTTC -3'

Sequencing Primer
(F):5'- CCAGGGATTAGTGACAGCC -3'
(R):5'- CACCCTCTAAGTGGGTACATC -3'
Posted On 2015-09-25