Incidental Mutation 'R4599:Pcdhgb1'
ID 345477
Institutional Source Beutler Lab
Gene Symbol Pcdhgb1
Ensembl Gene ENSMUSG00000103037
Gene Name protocadherin gamma subfamily B, 1
Synonyms
MMRRC Submission 041815-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.082) question?
Stock # R4599 (G1)
Quality Score 225
Status Not validated
Chromosome 18
Chromosomal Location 37813325-37974923 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 37814610 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Asparagine to Isoleucine at position 367 (N367I)
Ref Sequence ENSEMBL: ENSMUSP00000141348 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000073447] [ENSMUST00000115661] [ENSMUST00000192931] [ENSMUST00000193869] [ENSMUST00000194190] [ENSMUST00000194544] [ENSMUST00000194418]
AlphaFold Q91XX8
Predicted Effect probably benign
Transcript: ENSMUST00000073447
SMART Domains Protein: ENSMUSP00000073150
Gene: ENSMUSG00000104346

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
CA 42 128 2.15e-2 SMART
CA 152 237 4.8e-13 SMART
CA 261 342 9.36e-25 SMART
CA 366 447 6.62e-25 SMART
CA 471 557 6.72e-26 SMART
CA 588 666 2.15e-15 SMART
Pfam:Cadherin_C_2 685 768 4.8e-24 PFAM
Pfam:Cadherin_tail 805 928 8.1e-38 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000115661
SMART Domains Protein: ENSMUSP00000111325
Gene: ENSMUSG00000103458

DomainStartEndE-ValueType
CA 20 131 5.3e-2 SMART
CA 155 240 1.51e-19 SMART
CA 264 348 7.6e-25 SMART
CA 372 453 1.42e-24 SMART
CA 477 563 1.42e-24 SMART
CA 594 674 4.12e-12 SMART
low complexity region 706 721 N/A INTRINSIC
Pfam:Cadherin_tail 796 930 3.9e-58 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000192931
AA Change: N367I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000141348
Gene: ENSMUSG00000103037
AA Change: N367I

DomainStartEndE-ValueType
CA 36 119 8e-3 SMART
CA 143 228 1.34e-20 SMART
CA 252 333 1.52e-24 SMART
CA 357 438 9.22e-24 SMART
CA 462 548 1.24e-24 SMART
CA 579 660 1.3e-9 SMART
transmembrane domain 679 701 N/A INTRINSIC
low complexity region 899 918 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000193869
SMART Domains Protein: ENSMUSP00000141482
Gene: ENSMUSG00000103332

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
CA 45 131 1.64e-2 SMART
CA 155 240 6.42e-23 SMART
CA 264 345 1.76e-20 SMART
CA 369 450 2.27e-23 SMART
CA 474 560 1.5e-23 SMART
CA 591 669 1.17e-16 SMART
transmembrane domain 692 714 N/A INTRINSIC
low complexity region 912 931 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000193984
Predicted Effect probably benign
Transcript: ENSMUST00000194190
SMART Domains Protein: ENSMUSP00000142062
Gene: ENSMUSG00000103144

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
CA 31 131 3.16e-2 SMART
CA 155 240 5.39e-16 SMART
CA 264 345 6.72e-26 SMART
CA 369 450 1.32e-24 SMART
CA 474 560 4.17e-22 SMART
CA 591 669 4.48e-13 SMART
transmembrane domain 692 714 N/A INTRINSIC
low complexity region 912 931 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000195624
Predicted Effect probably benign
Transcript: ENSMUST00000194544
SMART Domains Protein: ENSMUSP00000141847
Gene: ENSMUSG00000102836

DomainStartEndE-ValueType
Blast:CA 18 66 5e-20 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000194418
SMART Domains Protein: ENSMUSP00000142140
Gene: ENSMUSG00000103677

DomainStartEndE-ValueType
CA 44 130 1.64e-2 SMART
CA 154 239 3.93e-18 SMART
CA 263 344 5.22e-23 SMART
CA 368 449 5.02e-25 SMART
CA 473 559 2.07e-26 SMART
CA 590 668 6.84e-18 SMART
transmembrane domain 690 712 N/A INTRINSIC
low complexity region 911 930 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the protocadherin gamma gene cluster, one of three related clusters tandemly linked on chromosome five. These gene clusters have an immunoglobulin-like organization, suggesting that a novel mechanism may be involved in their regulation and expression. The gamma gene cluster includes 22 genes divided into 3 subfamilies. Subfamily A contains 12 genes, subfamily B contains 7 genes and 2 pseudogenes, and the more distantly related subfamily C contains 3 genes. The tandem array of 22 large, variable region exons are followed by a constant region, containing 3 exons shared by all genes in the cluster. Each variable region exon encodes the extracellular region, which includes 6 cadherin ectodomains and a transmembrane region. The constant region exons encode the common cytoplasmic region. These neural cadherin-like cell adhesion proteins most likely play a critical role in the establishment and function of specific cell-cell connections in the brain. Alternative splicing has been described for the gamma cluster genes. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca14 T C 7: 119,854,626 (GRCm39) V930A probably benign Het
Ankrd13b T C 11: 77,362,494 (GRCm39) R677G probably benign Het
Apc T A 18: 34,451,040 (GRCm39) Y2611* probably null Het
Apold1 A G 6: 134,961,032 (GRCm39) Y162C probably damaging Het
Atp6v0a4 T C 6: 38,055,737 (GRCm39) I325V probably benign Het
Cab39 A G 1: 85,776,050 (GRCm39) Y249C probably damaging Het
Cd22 T A 7: 30,575,325 (GRCm39) H239L probably damaging Het
Chrna7 A G 7: 62,753,538 (GRCm39) M327T probably damaging Het
Cimip2b T C 4: 43,427,574 (GRCm39) H250R possibly damaging Het
Clock T C 5: 76,383,657 (GRCm39) M499V probably benign Het
Clspn A G 4: 126,475,253 (GRCm39) E1002G probably benign Het
Clta C T 4: 44,012,819 (GRCm39) P10S probably damaging Het
Col5a3 A G 9: 20,685,855 (GRCm39) probably null Het
Coq6 T C 12: 84,408,913 (GRCm39) V30A probably benign Het
Csmd2 G T 4: 127,881,921 (GRCm39) R20L probably benign Het
D430041D05Rik A T 2: 104,038,528 (GRCm39) V1547D probably damaging Het
Dapk1 C T 13: 60,865,861 (GRCm39) P153S probably benign Het
Dock2 T A 11: 34,189,536 (GRCm39) Y1545F probably damaging Het
Dpp6 G T 5: 27,839,546 (GRCm39) G354C probably damaging Het
Dyrk1b T C 7: 27,881,856 (GRCm39) L105P probably damaging Het
Epor A G 9: 21,873,155 (GRCm39) S86P probably benign Het
Gale C A 4: 135,695,148 (GRCm39) S341* probably null Het
Galnt4 T A 10: 98,945,355 (GRCm39) V360E probably damaging Het
Gart A T 16: 91,419,833 (GRCm39) C24* probably null Het
Gcnt2 G T 13: 41,040,966 (GRCm39) V42L probably benign Het
Herc6 A G 6: 57,636,698 (GRCm39) I805V probably benign Het
Ints12 T A 3: 132,804,214 (GRCm39) I67N probably benign Het
Irx1 C A 13: 72,108,232 (GRCm39) R150L probably damaging Het
Kif26b A G 1: 178,358,024 (GRCm39) Y45C unknown Het
Krt35 T C 11: 99,984,834 (GRCm39) T275A probably damaging Het
Laptm5 G T 4: 130,643,316 (GRCm39) probably benign Het
Lin7a T C 10: 107,248,027 (GRCm39) S111P unknown Het
Med27 A G 2: 29,414,470 (GRCm39) D159G probably damaging Het
Msh2 A G 17: 88,016,006 (GRCm39) K546R probably damaging Het
Myo1a A T 10: 127,556,020 (GRCm39) probably null Het
Myo1c T C 11: 75,559,019 (GRCm39) F604L probably damaging Het
Myrip A G 9: 120,293,850 (GRCm39) K782E probably damaging Het
Ndc80 T C 17: 71,828,063 (GRCm39) D88G probably damaging Het
Nrxn2 A G 19: 6,505,282 (GRCm39) D375G probably damaging Het
Or2y10 T C 11: 49,455,545 (GRCm39) S266P probably damaging Het
Or52e7 A G 7: 104,685,280 (GRCm39) I292V probably benign Het
Padi3 T C 4: 140,525,422 (GRCm39) H187R probably damaging Het
Pdrg1 T C 2: 152,854,310 (GRCm39) I77V probably benign Het
Pfas T C 11: 68,881,895 (GRCm39) E930G probably benign Het
Pik3cb C T 9: 98,943,817 (GRCm39) R662Q probably benign Het
Pla2g4e T G 2: 120,016,863 (GRCm39) H226P possibly damaging Het
Plxnd1 A T 6: 115,971,237 (GRCm39) V177E probably damaging Het
Prmt7 A G 8: 106,976,961 (GRCm39) S558G possibly damaging Het
Pspc1 A C 14: 57,015,246 (GRCm39) probably null Het
Rilp T C 11: 75,403,586 (GRCm39) S343P probably benign Het
Ror1 A G 4: 100,265,107 (GRCm39) M194V probably damaging Het
Rsu1 T C 2: 13,174,815 (GRCm39) Y225C probably damaging Het
Rundc1 A G 11: 101,324,752 (GRCm39) N486S probably damaging Het
Sema6d T A 2: 124,496,151 (GRCm39) I65N probably damaging Het
Slc5a11 A G 7: 122,857,601 (GRCm39) E230G probably benign Het
Spint1 T C 2: 119,076,941 (GRCm39) S342P probably damaging Het
Stard3nl A G 13: 19,551,923 (GRCm39) S214P probably damaging Het
Tcp10a A C 17: 7,604,323 (GRCm39) T271P probably damaging Het
Tie1 A G 4: 118,329,831 (GRCm39) Y1091H probably benign Het
Tlr12 T C 4: 128,511,125 (GRCm39) Y375C probably benign Het
Tmem107 T A 11: 68,962,274 (GRCm39) M77K probably damaging Het
Tns2 C T 15: 102,017,369 (GRCm39) R281C probably damaging Het
Tns3 T C 11: 8,481,747 (GRCm39) K202E probably damaging Het
Tspoap1 C T 11: 87,670,347 (GRCm39) P1634L probably damaging Het
Ttc7b G A 12: 100,466,376 (GRCm39) R79C probably damaging Het
Ush2a A G 1: 188,643,844 (GRCm39) N4402S probably benign Het
Vmn2r13 A T 5: 109,304,322 (GRCm39) I703N probably damaging Het
Xrcc4 A G 13: 90,210,126 (GRCm39) probably null Het
Zp3 A T 5: 136,013,089 (GRCm39) K168* probably null Het
Other mutations in Pcdhgb1
AlleleSourceChrCoordTypePredicted EffectPPH Score
PIT1430001:Pcdhgb1 UTSW 18 37,814,472 (GRCm39) missense probably damaging 1.00
R4433:Pcdhgb1 UTSW 18 37,814,304 (GRCm39) missense probably damaging 0.99
R4974:Pcdhgb1 UTSW 18 37,815,425 (GRCm39) missense probably benign 0.11
R5214:Pcdhgb1 UTSW 18 37,814,478 (GRCm39) missense probably damaging 1.00
R5621:Pcdhgb1 UTSW 18 37,815,222 (GRCm39) missense possibly damaging 0.90
R5981:Pcdhgb1 UTSW 18 37,814,907 (GRCm39) missense probably damaging 1.00
R6593:Pcdhgb1 UTSW 18 37,815,134 (GRCm39) missense probably damaging 1.00
R6666:Pcdhgb1 UTSW 18 37,814,546 (GRCm39) nonsense probably null
R6835:Pcdhgb1 UTSW 18 37,813,553 (GRCm39) missense probably benign 0.02
R6992:Pcdhgb1 UTSW 18 37,814,652 (GRCm39) missense probably benign 0.03
R7152:Pcdhgb1 UTSW 18 37,814,854 (GRCm39) missense probably benign 0.38
R7512:Pcdhgb1 UTSW 18 37,815,418 (GRCm39) missense probably damaging 1.00
R7583:Pcdhgb1 UTSW 18 37,815,377 (GRCm39) missense probably damaging 0.98
R8154:Pcdhgb1 UTSW 18 37,815,596 (GRCm39) missense probably damaging 0.98
R8513:Pcdhgb1 UTSW 18 37,813,581 (GRCm39) missense probably damaging 1.00
R8517:Pcdhgb1 UTSW 18 37,815,117 (GRCm39) missense possibly damaging 0.47
R8725:Pcdhgb1 UTSW 18 37,814,467 (GRCm39) nonsense probably null
R8997:Pcdhgb1 UTSW 18 37,814,133 (GRCm39) missense probably damaging 1.00
R9092:Pcdhgb1 UTSW 18 37,813,989 (GRCm39) missense possibly damaging 0.87
R9195:Pcdhgb1 UTSW 18 37,814,157 (GRCm39) missense probably damaging 0.99
R9350:Pcdhgb1 UTSW 18 37,814,705 (GRCm39) missense probably benign 0.00
Z1176:Pcdhgb1 UTSW 18 37,814,893 (GRCm39) missense probably benign 0.24
Z1177:Pcdhgb1 UTSW 18 37,815,387 (GRCm39) missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- CTGGAGCTATCACAACTAATGGTAC -3'
(R):5'- ACACATGTCTTGGAGGAAAGC -3'

Sequencing Primer
(F):5'- GTGTAGAAGCCAAGGACGG -3'
(R):5'- CGAGGGCTTGCCACTGTC -3'
Posted On 2015-09-25