Incidental Mutation 'R4599:Nrxn2'
ID 345478
Institutional Source Beutler Lab
Gene Symbol Nrxn2
Ensembl Gene ENSMUSG00000033768
Gene Name neurexin II
Synonyms neurexin II alpha, neurexin II beta, 6430591O13Rik
MMRRC Submission 041815-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R4599 (G1)
Quality Score 225
Status Not validated
Chromosome 19
Chromosomal Location 6468786-6583247 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 6505282 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 375 (D375G)
Ref Sequence ENSEMBL: ENSMUSP00000109089 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000077182] [ENSMUST00000113461] [ENSMUST00000113462] [ENSMUST00000137166] [ENSMUST00000137821]
AlphaFold E9Q7X7
Predicted Effect possibly damaging
Transcript: ENSMUST00000077182
AA Change: D375G

PolyPhen 2 Score 0.538 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000076424
Gene: ENSMUSG00000033768
AA Change: D375G

DomainStartEndE-ValueType
low complexity region 8 24 N/A INTRINSIC
LamG 49 187 1.67e-33 SMART
EGF 205 242 1.73e1 SMART
low complexity region 268 276 N/A INTRINSIC
LamG 310 444 1.18e-33 SMART
LamG 498 651 1.51e-40 SMART
EGF 678 712 8.91e-3 SMART
LamG 737 875 4.91e-22 SMART
LamG 923 1059 1.08e-41 SMART
EGF 1084 1118 1.91e1 SMART
LamG 1146 1303 4.48e-16 SMART
low complexity region 1332 1362 N/A INTRINSIC
low complexity region 1430 1445 N/A INTRINSIC
4.1m 1448 1466 3.75e-4 SMART
low complexity region 1480 1499 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000113461
AA Change: D351G

PolyPhen 2 Score 0.924 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000109088
Gene: ENSMUSG00000033768
AA Change: D351G

DomainStartEndE-ValueType
low complexity region 8 24 N/A INTRINSIC
LamG 49 187 1.67e-33 SMART
EGF 205 242 1.73e1 SMART
LamG 286 428 8.4e-30 SMART
LamG 482 635 1.51e-40 SMART
EGF 662 696 8.91e-3 SMART
LamG 721 850 2.36e-24 SMART
LamG 898 1034 1.08e-41 SMART
EGF 1059 1093 1.91e1 SMART
LamG 1121 1248 1.26e-19 SMART
low complexity region 1277 1307 N/A INTRINSIC
low complexity region 1363 1384 N/A INTRINSIC
low complexity region 1567 1582 N/A INTRINSIC
4.1m 1585 1603 3.75e-4 SMART
low complexity region 1617 1636 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000113462
AA Change: D375G

PolyPhen 2 Score 0.980 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000109089
Gene: ENSMUSG00000033768
AA Change: D375G

DomainStartEndE-ValueType
low complexity region 8 24 N/A INTRINSIC
LamG 49 187 1.67e-33 SMART
EGF 205 242 1.73e1 SMART
low complexity region 268 276 N/A INTRINSIC
LamG 310 452 8.4e-30 SMART
LamG 506 659 1.51e-40 SMART
EGF 686 720 8.91e-3 SMART
LamG 745 883 4.91e-22 SMART
LamG 931 1067 1.08e-41 SMART
EGF 1092 1126 1.91e1 SMART
LamG 1154 1311 4.48e-16 SMART
low complexity region 1340 1370 N/A INTRINSIC
low complexity region 1426 1447 N/A INTRINSIC
low complexity region 1630 1645 N/A INTRINSIC
4.1m 1648 1666 3.75e-4 SMART
low complexity region 1680 1699 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124815
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128272
Predicted Effect possibly damaging
Transcript: ENSMUST00000137166
AA Change: D375G

PolyPhen 2 Score 0.899 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000119762
Gene: ENSMUSG00000033768
AA Change: D375G

DomainStartEndE-ValueType
low complexity region 8 24 N/A INTRINSIC
LamG 49 187 1.67e-33 SMART
EGF 205 242 1.73e1 SMART
low complexity region 268 276 N/A INTRINSIC
LamG 310 459 8.87e-29 SMART
LamG 513 666 1.51e-40 SMART
EGF 693 727 8.91e-3 SMART
LamG 752 890 4.91e-22 SMART
LamG 938 1074 1.08e-41 SMART
EGF 1099 1133 1.91e1 SMART
LamG 1161 1318 4.48e-16 SMART
low complexity region 1347 1377 N/A INTRINSIC
low complexity region 1433 1454 N/A INTRINSIC
low complexity region 1637 1652 N/A INTRINSIC
4.1m 1655 1673 3.75e-4 SMART
low complexity region 1687 1706 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000137821
AA Change: D166G

PolyPhen 2 Score 0.161 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000122920
Gene: ENSMUSG00000033768
AA Change: D166G

DomainStartEndE-ValueType
EGF 6 43 1.73e1 SMART
low complexity region 59 67 N/A INTRINSIC
LamG 101 212 1.63e-18 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150792
Predicted Effect unknown
Transcript: ENSMUST00000155158
AA Change: D135G
SMART Domains Protein: ENSMUSP00000118878
Gene: ENSMUSG00000033768
AA Change: D135G

DomainStartEndE-ValueType
Blast:LamG 2 45 8e-7 BLAST
LamG 71 205 1.18e-33 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000157014
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the neurexin gene family. The products of these genes function as cell adhesion molecules and receptors in the vertebrate nervous system. These genes utilize two promoters. The majority of transcripts are produced from the upstream promoter and encode alpha-neurexin isoforms while a smaller number of transcripts are produced from the downstream promoter and encode beta-neuresin isoforms. The alpha-neurexins contain epidermal growth factor-like (EGF-like) sequences and laminin G domains, and have been shown to interact with neurexophilins. The beta-neurexins lack EGF-like sequences and contain fewer laminin G domains than alpha-neurexins. Alternative splicing and the use of alternative promoters may generate thousands of transcript variants (PMID: 12036300, PMID: 11944992).[provided by RefSeq, Jun 2010]
PHENOTYPE: Mice homozygous for a knock-out allele are generally non-viable; surviving homozygotes show a 30-40% decrease in body weight and their inhibitory postsynaptic currents (IPSCs) are decreased in cortical slice cultures. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca14 T C 7: 119,854,626 (GRCm39) V930A probably benign Het
Ankrd13b T C 11: 77,362,494 (GRCm39) R677G probably benign Het
Apc T A 18: 34,451,040 (GRCm39) Y2611* probably null Het
Apold1 A G 6: 134,961,032 (GRCm39) Y162C probably damaging Het
Atp6v0a4 T C 6: 38,055,737 (GRCm39) I325V probably benign Het
Cab39 A G 1: 85,776,050 (GRCm39) Y249C probably damaging Het
Cd22 T A 7: 30,575,325 (GRCm39) H239L probably damaging Het
Chrna7 A G 7: 62,753,538 (GRCm39) M327T probably damaging Het
Cimip2b T C 4: 43,427,574 (GRCm39) H250R possibly damaging Het
Clock T C 5: 76,383,657 (GRCm39) M499V probably benign Het
Clspn A G 4: 126,475,253 (GRCm39) E1002G probably benign Het
Clta C T 4: 44,012,819 (GRCm39) P10S probably damaging Het
Col5a3 A G 9: 20,685,855 (GRCm39) probably null Het
Coq6 T C 12: 84,408,913 (GRCm39) V30A probably benign Het
Csmd2 G T 4: 127,881,921 (GRCm39) R20L probably benign Het
D430041D05Rik A T 2: 104,038,528 (GRCm39) V1547D probably damaging Het
Dapk1 C T 13: 60,865,861 (GRCm39) P153S probably benign Het
Dock2 T A 11: 34,189,536 (GRCm39) Y1545F probably damaging Het
Dpp6 G T 5: 27,839,546 (GRCm39) G354C probably damaging Het
Dyrk1b T C 7: 27,881,856 (GRCm39) L105P probably damaging Het
Epor A G 9: 21,873,155 (GRCm39) S86P probably benign Het
Gale C A 4: 135,695,148 (GRCm39) S341* probably null Het
Galnt4 T A 10: 98,945,355 (GRCm39) V360E probably damaging Het
Gart A T 16: 91,419,833 (GRCm39) C24* probably null Het
Gcnt2 G T 13: 41,040,966 (GRCm39) V42L probably benign Het
Herc6 A G 6: 57,636,698 (GRCm39) I805V probably benign Het
Ints12 T A 3: 132,804,214 (GRCm39) I67N probably benign Het
Irx1 C A 13: 72,108,232 (GRCm39) R150L probably damaging Het
Kif26b A G 1: 178,358,024 (GRCm39) Y45C unknown Het
Krt35 T C 11: 99,984,834 (GRCm39) T275A probably damaging Het
Laptm5 G T 4: 130,643,316 (GRCm39) probably benign Het
Lin7a T C 10: 107,248,027 (GRCm39) S111P unknown Het
Med27 A G 2: 29,414,470 (GRCm39) D159G probably damaging Het
Msh2 A G 17: 88,016,006 (GRCm39) K546R probably damaging Het
Myo1a A T 10: 127,556,020 (GRCm39) probably null Het
Myo1c T C 11: 75,559,019 (GRCm39) F604L probably damaging Het
Myrip A G 9: 120,293,850 (GRCm39) K782E probably damaging Het
Ndc80 T C 17: 71,828,063 (GRCm39) D88G probably damaging Het
Or2y10 T C 11: 49,455,545 (GRCm39) S266P probably damaging Het
Or52e7 A G 7: 104,685,280 (GRCm39) I292V probably benign Het
Padi3 T C 4: 140,525,422 (GRCm39) H187R probably damaging Het
Pcdhgb1 A T 18: 37,814,610 (GRCm39) N367I probably damaging Het
Pdrg1 T C 2: 152,854,310 (GRCm39) I77V probably benign Het
Pfas T C 11: 68,881,895 (GRCm39) E930G probably benign Het
Pik3cb C T 9: 98,943,817 (GRCm39) R662Q probably benign Het
Pla2g4e T G 2: 120,016,863 (GRCm39) H226P possibly damaging Het
Plxnd1 A T 6: 115,971,237 (GRCm39) V177E probably damaging Het
Prmt7 A G 8: 106,976,961 (GRCm39) S558G possibly damaging Het
Pspc1 A C 14: 57,015,246 (GRCm39) probably null Het
Rilp T C 11: 75,403,586 (GRCm39) S343P probably benign Het
Ror1 A G 4: 100,265,107 (GRCm39) M194V probably damaging Het
Rsu1 T C 2: 13,174,815 (GRCm39) Y225C probably damaging Het
Rundc1 A G 11: 101,324,752 (GRCm39) N486S probably damaging Het
Sema6d T A 2: 124,496,151 (GRCm39) I65N probably damaging Het
Slc5a11 A G 7: 122,857,601 (GRCm39) E230G probably benign Het
Spint1 T C 2: 119,076,941 (GRCm39) S342P probably damaging Het
Stard3nl A G 13: 19,551,923 (GRCm39) S214P probably damaging Het
Tcp10a A C 17: 7,604,323 (GRCm39) T271P probably damaging Het
Tie1 A G 4: 118,329,831 (GRCm39) Y1091H probably benign Het
Tlr12 T C 4: 128,511,125 (GRCm39) Y375C probably benign Het
Tmem107 T A 11: 68,962,274 (GRCm39) M77K probably damaging Het
Tns2 C T 15: 102,017,369 (GRCm39) R281C probably damaging Het
Tns3 T C 11: 8,481,747 (GRCm39) K202E probably damaging Het
Tspoap1 C T 11: 87,670,347 (GRCm39) P1634L probably damaging Het
Ttc7b G A 12: 100,466,376 (GRCm39) R79C probably damaging Het
Ush2a A G 1: 188,643,844 (GRCm39) N4402S probably benign Het
Vmn2r13 A T 5: 109,304,322 (GRCm39) I703N probably damaging Het
Xrcc4 A G 13: 90,210,126 (GRCm39) probably null Het
Zp3 A T 5: 136,013,089 (GRCm39) K168* probably null Het
Other mutations in Nrxn2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00490:Nrxn2 APN 19 6,523,623 (GRCm39) missense possibly damaging 0.84
IGL01020:Nrxn2 APN 19 6,543,473 (GRCm39) missense probably benign 0.02
IGL01064:Nrxn2 APN 19 6,567,083 (GRCm39) missense probably damaging 0.97
IGL01561:Nrxn2 APN 19 6,540,172 (GRCm39) missense probably damaging 1.00
IGL01759:Nrxn2 APN 19 6,559,959 (GRCm39) missense probably damaging 1.00
IGL02071:Nrxn2 APN 19 6,531,783 (GRCm39) missense probably damaging 1.00
IGL02085:Nrxn2 APN 19 6,542,898 (GRCm39) missense possibly damaging 0.83
IGL02132:Nrxn2 APN 19 6,522,306 (GRCm39) missense probably damaging 1.00
IGL02476:Nrxn2 APN 19 6,505,015 (GRCm39) missense probably damaging 1.00
IGL02605:Nrxn2 APN 19 6,500,610 (GRCm39) missense probably benign 0.02
IGL03123:Nrxn2 APN 19 6,531,767 (GRCm39) missense probably damaging 0.98
IGL03288:Nrxn2 APN 19 6,540,726 (GRCm39) missense probably damaging 1.00
PIT4687001:Nrxn2 UTSW 19 6,531,338 (GRCm39) missense probably benign 0.06
R0019:Nrxn2 UTSW 19 6,559,987 (GRCm39) splice site probably benign
R0257:Nrxn2 UTSW 19 6,540,728 (GRCm39) missense possibly damaging 0.81
R0305:Nrxn2 UTSW 19 6,569,313 (GRCm39) missense probably damaging 1.00
R0453:Nrxn2 UTSW 19 6,541,551 (GRCm39) missense probably damaging 1.00
R0512:Nrxn2 UTSW 19 6,567,228 (GRCm39) missense probably damaging 1.00
R0539:Nrxn2 UTSW 19 6,543,434 (GRCm39) missense probably damaging 0.99
R0571:Nrxn2 UTSW 19 6,523,563 (GRCm39) missense probably damaging 1.00
R1373:Nrxn2 UTSW 19 6,522,331 (GRCm39) missense probably damaging 1.00
R1434:Nrxn2 UTSW 19 6,493,642 (GRCm39) splice site probably null
R1454:Nrxn2 UTSW 19 6,531,476 (GRCm39) missense probably damaging 0.98
R1671:Nrxn2 UTSW 19 6,523,780 (GRCm39) missense probably damaging 1.00
R1692:Nrxn2 UTSW 19 6,569,298 (GRCm39) missense probably damaging 1.00
R1858:Nrxn2 UTSW 19 6,538,825 (GRCm39) missense probably benign 0.01
R1859:Nrxn2 UTSW 19 6,538,825 (GRCm39) missense probably benign 0.01
R2153:Nrxn2 UTSW 19 6,554,944 (GRCm39) missense probably damaging 1.00
R2196:Nrxn2 UTSW 19 6,540,139 (GRCm39) missense probably damaging 1.00
R2209:Nrxn2 UTSW 19 6,543,037 (GRCm39) missense probably benign 0.01
R2278:Nrxn2 UTSW 19 6,531,883 (GRCm39) missense probably damaging 1.00
R2441:Nrxn2 UTSW 19 6,478,331 (GRCm39) missense probably damaging 1.00
R3897:Nrxn2 UTSW 19 6,569,287 (GRCm39) missense probably damaging 1.00
R3943:Nrxn2 UTSW 19 6,523,365 (GRCm39) missense probably damaging 1.00
R4091:Nrxn2 UTSW 19 6,523,444 (GRCm39) missense probably damaging 1.00
R4162:Nrxn2 UTSW 19 6,582,173 (GRCm39) missense probably damaging 1.00
R4164:Nrxn2 UTSW 19 6,582,173 (GRCm39) missense probably damaging 1.00
R4495:Nrxn2 UTSW 19 6,581,429 (GRCm39) missense probably benign 0.05
R4735:Nrxn2 UTSW 19 6,548,484 (GRCm39) missense possibly damaging 0.86
R4757:Nrxn2 UTSW 19 6,559,851 (GRCm39) missense probably damaging 1.00
R4890:Nrxn2 UTSW 19 6,498,308 (GRCm39) missense possibly damaging 0.90
R5052:Nrxn2 UTSW 19 6,505,234 (GRCm39) missense probably damaging 1.00
R5311:Nrxn2 UTSW 19 6,581,428 (GRCm39) missense probably benign 0.05
R5330:Nrxn2 UTSW 19 6,540,111 (GRCm39) missense probably damaging 0.96
R5331:Nrxn2 UTSW 19 6,540,111 (GRCm39) missense probably damaging 0.96
R5530:Nrxn2 UTSW 19 6,548,397 (GRCm39) missense possibly damaging 0.93
R5556:Nrxn2 UTSW 19 6,540,121 (GRCm39) missense probably damaging 1.00
R5763:Nrxn2 UTSW 19 6,581,369 (GRCm39) missense probably benign 0.15
R5829:Nrxn2 UTSW 19 6,540,879 (GRCm39) missense probably benign 0.03
R5988:Nrxn2 UTSW 19 6,542,901 (GRCm39) missense possibly damaging 0.83
R6003:Nrxn2 UTSW 19 6,548,358 (GRCm39) missense possibly damaging 0.93
R6032:Nrxn2 UTSW 19 6,567,162 (GRCm39) missense probably damaging 1.00
R6032:Nrxn2 UTSW 19 6,567,162 (GRCm39) missense probably damaging 1.00
R6288:Nrxn2 UTSW 19 6,540,591 (GRCm39) missense probably damaging 1.00
R6334:Nrxn2 UTSW 19 6,581,322 (GRCm39) splice site probably null
R6373:Nrxn2 UTSW 19 6,559,860 (GRCm39) missense probably damaging 1.00
R6397:Nrxn2 UTSW 19 6,582,152 (GRCm39) missense probably damaging 1.00
R6669:Nrxn2 UTSW 19 6,531,221 (GRCm39) missense probably damaging 1.00
R6980:Nrxn2 UTSW 19 6,500,609 (GRCm39) missense probably benign 0.04
R6985:Nrxn2 UTSW 19 6,531,275 (GRCm39) missense probably damaging 1.00
R7184:Nrxn2 UTSW 19 6,540,582 (GRCm39) missense probably damaging 1.00
R7361:Nrxn2 UTSW 19 6,567,112 (GRCm39) missense probably benign 0.00
R7576:Nrxn2 UTSW 19 6,581,540 (GRCm39) nonsense probably null
R7604:Nrxn2 UTSW 19 6,581,991 (GRCm39) missense probably damaging 1.00
R7631:Nrxn2 UTSW 19 6,531,825 (GRCm39) missense possibly damaging 0.83
R7768:Nrxn2 UTSW 19 6,531,409 (GRCm39) missense possibly damaging 0.69
R7805:Nrxn2 UTSW 19 6,581,736 (GRCm39) missense probably benign
R7896:Nrxn2 UTSW 19 6,582,083 (GRCm39) missense possibly damaging 0.89
R7998:Nrxn2 UTSW 19 6,559,905 (GRCm39) missense probably damaging 0.98
R8383:Nrxn2 UTSW 19 6,522,343 (GRCm39) missense probably damaging 1.00
R8505:Nrxn2 UTSW 19 6,540,163 (GRCm39) missense probably damaging 1.00
R8843:Nrxn2 UTSW 19 6,555,057 (GRCm39) missense probably damaging 1.00
R8881:Nrxn2 UTSW 19 6,554,920 (GRCm39) missense probably benign 0.07
R9086:Nrxn2 UTSW 19 6,540,108 (GRCm39) missense probably damaging 1.00
R9139:Nrxn2 UTSW 19 6,498,299 (GRCm39) missense probably benign 0.02
R9420:Nrxn2 UTSW 19 6,581,931 (GRCm39) missense probably benign 0.40
R9445:Nrxn2 UTSW 19 6,522,448 (GRCm39) missense probably damaging 0.99
R9564:Nrxn2 UTSW 19 6,559,887 (GRCm39) missense probably damaging 1.00
R9609:Nrxn2 UTSW 19 6,540,203 (GRCm39) missense probably damaging 1.00
R9708:Nrxn2 UTSW 19 6,581,882 (GRCm39) missense probably benign 0.00
R9794:Nrxn2 UTSW 19 6,567,064 (GRCm39) missense possibly damaging 0.48
X0022:Nrxn2 UTSW 19 6,559,947 (GRCm39) missense probably damaging 1.00
Z1177:Nrxn2 UTSW 19 6,548,547 (GRCm39) missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- GCACTGACGAGATCACACTG -3'
(R):5'- TAAGGTCTCAGAAGCCTGTCAC -3'

Sequencing Primer
(F):5'- TGACGAGATCACACTGGCCTTC -3'
(R):5'- GAAGCCTGTCACATAGCTGAGTTC -3'
Posted On 2015-09-25