Incidental Mutation 'R4600:Xdh'
ID 345581
Institutional Source Beutler Lab
Gene Symbol Xdh
Ensembl Gene ENSMUSG00000024066
Gene Name xanthine dehydrogenase
Synonyms Xox-1, XO, Xor, Xox1, xanthine oxidase
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.430) question?
Stock # R4600 (G1)
Quality Score 225
Status Not validated
Chromosome 17
Chromosomal Location 74190890-74257191 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to T at 74217195 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Asparagine at position 691 (T691N)
Ref Sequence ENSEMBL: ENSMUSP00000024866 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024866]
AlphaFold Q00519
Predicted Effect probably benign
Transcript: ENSMUST00000024866
AA Change: T691N

PolyPhen 2 Score 0.194 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000024866
Gene: ENSMUSG00000024066
AA Change: T691N

DomainStartEndE-ValueType
Pfam:Fer2 11 81 5e-12 PFAM
Pfam:Fer2_2 90 163 4.1e-31 PFAM
low complexity region 169 182 N/A INTRINSIC
Pfam:FAD_binding_5 234 414 4.9e-47 PFAM
CO_deh_flav_C 421 525 1.16e-24 SMART
Ald_Xan_dh_C 590 696 1.23e-46 SMART
Pfam:Ald_Xan_dh_C2 704 1239 1e-200 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the xanthine dehydrogenase protein family. The encoded protein has been identified as a moonlighting protein based on its ability to perform mechanistically distinct functions. The encoded protein exists as two distinct enzymatic forms, either as xanthine dehydrogenase, or as xanthine oxidase, and functions in purine degradation. Additional studies also suggest a role in adipogenesis, and a function as a structural protein in milk fat droplets in the lactating mammary gland. [provided by RefSeq, Jan 2014]
PHENOTYPE: Homozygotes for a null allele are small and die prematurely while heterozygous females show a lactation defect. Most homozygotes for another null allele die within the first month of renal failure associated with uric acid depletion, renal tubular damage, inflammation, fibrosis and oxidative stress. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 94 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700049A03Rik T C 12: 71,195,037 (GRCm39) F145L possibly damaging Het
Aars2 T A 17: 45,827,847 (GRCm39) D555E probably damaging Het
Ago1 C A 4: 126,354,185 (GRCm39) M208I probably benign Het
Ak7 G A 12: 105,679,834 (GRCm39) V123M probably benign Het
Amfr A G 8: 94,700,849 (GRCm39) L537P probably damaging Het
Apob A G 12: 8,058,568 (GRCm39) D2317G probably damaging Het
Asb6 T A 2: 30,714,483 (GRCm39) D209V probably damaging Het
AY358078 T A 14: 52,063,532 (GRCm39) C393S possibly damaging Het
Baz2a T A 10: 127,957,052 (GRCm39) C932S probably damaging Het
Btnl10 A G 11: 58,814,426 (GRCm39) I369V probably benign Het
Ccdc66 T C 14: 27,222,377 (GRCm39) N122S probably damaging Het
Cfap96 A T 8: 46,423,505 (GRCm39) I69N probably damaging Het
Clic4 A T 4: 134,966,300 (GRCm39) probably null Het
Col6a3 A G 1: 90,709,626 (GRCm39) S1857P unknown Het
Cracr2a A C 6: 127,580,851 (GRCm39) D9A probably benign Het
Cspg4b A G 13: 113,455,783 (GRCm39) R610G possibly damaging Het
Dcst1 T C 3: 89,263,643 (GRCm39) E384G probably benign Het
Ddx4 T C 13: 112,748,594 (GRCm39) K435E probably damaging Het
Deaf1 T A 7: 140,890,884 (GRCm39) T433S possibly damaging Het
Dnah3 T A 7: 119,689,169 (GRCm39) M82L probably benign Het
Dnhd1 G T 7: 105,352,851 (GRCm39) R2668L probably damaging Het
Efcab6 C T 15: 83,831,126 (GRCm39) G596D probably benign Het
Ercc3 G A 18: 32,378,624 (GRCm39) A202T probably benign Het
Fam181b C A 7: 92,729,992 (GRCm39) A255E possibly damaging Het
Fam83e T A 7: 45,372,924 (GRCm39) D178E probably benign Het
Frem2 A G 3: 53,455,228 (GRCm39) L2116S possibly damaging Het
Gm16494 T A 17: 47,327,723 (GRCm39) K54* probably null Het
Golgb1 A G 16: 36,738,987 (GRCm39) D2442G probably damaging Het
Greb1l G A 18: 10,553,705 (GRCm39) A1569T probably damaging Het
Grik5 C G 7: 24,767,489 (GRCm39) E64Q probably damaging Het
Gstm5 A G 3: 107,805,302 (GRCm39) Y130C probably damaging Het
Gucy2e C G 11: 69,126,994 (GRCm39) A160P possibly damaging Het
Hydin A T 8: 111,293,582 (GRCm39) T3510S probably benign Het
Ift70a1 T C 2: 75,810,977 (GRCm39) T369A probably benign Het
Itgb2 A G 10: 77,381,949 (GRCm39) I84V probably benign Het
Itsn1 A G 16: 91,696,475 (GRCm39) Q26R probably damaging Het
Kat6a A G 8: 23,429,327 (GRCm39) S1561G probably benign Het
Khnyn G A 14: 56,124,438 (GRCm39) V231I probably benign Het
Kif21b A G 1: 136,075,602 (GRCm39) D243G probably benign Het
Klk4 T A 7: 43,534,762 (GRCm39) N240K probably damaging Het
Knl1 T C 2: 118,901,025 (GRCm39) S909P possibly damaging Het
Lamb1 A C 12: 31,373,528 (GRCm39) D1419A probably benign Het
Lin9 T A 1: 180,508,759 (GRCm39) V421D probably damaging Het
Lipt2 T C 7: 99,809,519 (GRCm39) L202P probably benign Het
Mbd5 T G 2: 49,147,209 (GRCm39) M473R probably benign Het
Mcc A T 18: 44,652,587 (GRCm39) I279N probably damaging Het
Mcpt9 C T 14: 56,266,049 (GRCm39) V60M probably damaging Het
Mrc2 G A 11: 105,239,257 (GRCm39) probably null Het
Mslnl G A 17: 25,961,908 (GRCm39) V128M probably damaging Het
Mylk2 G A 2: 152,759,476 (GRCm39) V389M probably damaging Het
Ndufs7 T A 10: 80,092,501 (GRCm39) Y203* probably null Het
Nup160 T A 2: 90,515,541 (GRCm39) probably null Het
Nup88 G A 11: 70,860,522 (GRCm39) R62* probably null Het
Or2g7 T C 17: 38,378,853 (GRCm39) S264P probably damaging Het
Or51af1 T A 7: 103,141,788 (GRCm39) Q99L probably damaging Het
Or6c207 G A 10: 129,104,274 (GRCm39) A306V probably benign Het
Or8b8 T A 9: 37,809,622 (GRCm39) S307R probably benign Het
Or8g33 A G 9: 39,337,731 (GRCm39) M212T probably benign Het
Os9 T C 10: 126,934,223 (GRCm39) N471S probably benign Het
Otof C T 5: 30,529,244 (GRCm39) V1757M probably damaging Het
Pakap A T 4: 57,709,954 (GRCm39) T300S probably benign Het
Pald1 T C 10: 61,184,395 (GRCm39) T241A probably benign Het
Pappa2 G A 1: 158,642,015 (GRCm39) S1347L probably damaging Het
Pccb T C 9: 100,916,832 (GRCm39) T27A probably benign Het
Pde4dip A T 3: 97,603,260 (GRCm39) V2243D probably damaging Het
Pkd2l2 C A 18: 34,571,254 (GRCm39) Q590K probably benign Het
Pmepa1 G A 2: 173,070,120 (GRCm39) P145L possibly damaging Het
Ppp3cb T C 14: 20,570,714 (GRCm39) N339S possibly damaging Het
Rnf133 T C 6: 23,649,041 (GRCm39) E296G possibly damaging Het
Secisbp2l C T 2: 125,582,657 (GRCm39) G933D possibly damaging Het
Serpinb12 T A 1: 106,876,883 (GRCm39) D66E probably benign Het
Slc35e2 T C 4: 155,702,106 (GRCm39) F290S probably benign Het
Slc46a2 C T 4: 59,911,886 (GRCm39) C442Y probably damaging Het
Slc7a1 A G 5: 148,278,869 (GRCm39) L301P probably damaging Het
Spg21 A G 9: 65,383,257 (GRCm39) T148A probably benign Het
Stox2 A G 8: 47,645,970 (GRCm39) S497P probably damaging Het
Sult1c2 C A 17: 54,280,983 (GRCm39) W40L probably benign Het
Sytl2 T C 7: 90,024,977 (GRCm39) S322P probably benign Het
Telo2 C A 17: 25,324,122 (GRCm39) R531L possibly damaging Het
Thbs3 T C 3: 89,131,897 (GRCm39) V719A probably damaging Het
Tlr9 T A 9: 106,101,732 (GRCm39) L341Q probably damaging Het
Tmprss5 A G 9: 49,024,548 (GRCm39) N230D possibly damaging Het
Tns2 C T 15: 102,017,369 (GRCm39) R281C probably damaging Het
Tpo C T 12: 30,148,228 (GRCm39) V558M probably benign Het
Trex1 T G 9: 108,887,352 (GRCm39) Q213P possibly damaging Het
Ttc7b G A 12: 100,466,376 (GRCm39) R79C probably damaging Het
Ugt1a6a A G 1: 88,066,586 (GRCm39) K131E probably benign Het
Vipr1 T A 9: 121,494,202 (GRCm39) probably null Het
Vmn1r22 T C 6: 57,877,860 (GRCm39) D39G probably damaging Het
Vmn2r58 A T 7: 41,522,046 (GRCm39) C17S probably benign Het
Vps41 T C 13: 18,929,453 (GRCm39) Y63H probably damaging Het
Zfp518b T C 5: 38,830,970 (GRCm39) N345S probably damaging Het
Zfp536 T A 7: 37,267,918 (GRCm39) K499N probably damaging Het
Zfp963 A T 8: 70,195,510 (GRCm39) probably null Het
Other mutations in Xdh
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00493:Xdh APN 17 74,230,101 (GRCm39) missense possibly damaging 0.58
IGL00556:Xdh APN 17 74,191,430 (GRCm39) makesense probably null
IGL01524:Xdh APN 17 74,230,132 (GRCm39) critical splice acceptor site probably null
IGL01604:Xdh APN 17 74,216,332 (GRCm39) missense probably benign 0.02
IGL01625:Xdh APN 17 74,223,781 (GRCm39) critical splice donor site probably null
IGL01778:Xdh APN 17 74,207,275 (GRCm39) missense probably benign 0.00
IGL01804:Xdh APN 17 74,199,754 (GRCm39) missense probably damaging 1.00
IGL01825:Xdh APN 17 74,198,240 (GRCm39) missense probably damaging 1.00
IGL01929:Xdh APN 17 74,241,850 (GRCm39) missense probably damaging 1.00
IGL02068:Xdh APN 17 74,220,945 (GRCm39) missense probably damaging 1.00
IGL02079:Xdh APN 17 74,198,272 (GRCm39) missense probably damaging 1.00
IGL02210:Xdh APN 17 74,250,890 (GRCm39) missense probably benign 0.00
IGL02261:Xdh APN 17 74,220,960 (GRCm39) missense possibly damaging 0.81
IGL02365:Xdh APN 17 74,250,885 (GRCm39) missense probably benign 0.14
IGL02424:Xdh APN 17 74,233,565 (GRCm39) missense probably benign 0.00
IGL02491:Xdh APN 17 74,193,459 (GRCm39) missense probably damaging 0.99
IGL02525:Xdh APN 17 74,231,990 (GRCm39) missense possibly damaging 0.91
IGL02578:Xdh APN 17 74,213,241 (GRCm39) missense probably damaging 1.00
IGL02793:Xdh APN 17 74,207,576 (GRCm39) missense probably damaging 1.00
IGL02939:Xdh APN 17 74,250,840 (GRCm39) critical splice donor site probably null
IGL03327:Xdh APN 17 74,223,787 (GRCm39) missense probably benign
IGL03345:Xdh APN 17 74,213,027 (GRCm39) missense probably damaging 0.98
IGL03353:Xdh APN 17 74,202,781 (GRCm39) missense possibly damaging 0.65
inky UTSW 17 74,228,346 (GRCm39) missense probably damaging 1.00
nucleus UTSW 17 74,206,007 (GRCm39) nonsense probably null
squidgame UTSW 17 74,246,831 (GRCm39) missense probably benign
R0018:Xdh UTSW 17 74,232,020 (GRCm39) missense probably benign 0.00
R0018:Xdh UTSW 17 74,232,020 (GRCm39) missense probably benign 0.00
R0033:Xdh UTSW 17 74,214,627 (GRCm39) missense probably benign 0.06
R0079:Xdh UTSW 17 74,198,213 (GRCm39) missense probably damaging 1.00
R0086:Xdh UTSW 17 74,191,433 (GRCm39) missense probably benign
R0319:Xdh UTSW 17 74,213,096 (GRCm39) splice site probably benign
R0336:Xdh UTSW 17 74,229,458 (GRCm39) missense possibly damaging 0.91
R0389:Xdh UTSW 17 74,205,357 (GRCm39) missense probably damaging 1.00
R0684:Xdh UTSW 17 74,250,886 (GRCm39) missense probably damaging 0.97
R0930:Xdh UTSW 17 74,230,077 (GRCm39) missense probably benign 0.00
R1073:Xdh UTSW 17 74,246,831 (GRCm39) missense probably benign
R1114:Xdh UTSW 17 74,248,144 (GRCm39) splice site probably benign
R1201:Xdh UTSW 17 74,225,413 (GRCm39) missense probably benign 0.05
R1230:Xdh UTSW 17 74,198,251 (GRCm39) missense probably damaging 1.00
R1351:Xdh UTSW 17 74,230,073 (GRCm39) missense probably benign 0.02
R1470:Xdh UTSW 17 74,198,107 (GRCm39) missense probably damaging 1.00
R1470:Xdh UTSW 17 74,198,107 (GRCm39) missense probably damaging 1.00
R1485:Xdh UTSW 17 74,221,014 (GRCm39) nonsense probably null
R1548:Xdh UTSW 17 74,220,896 (GRCm39) missense probably damaging 0.98
R1637:Xdh UTSW 17 74,207,573 (GRCm39) missense probably benign
R1641:Xdh UTSW 17 74,233,547 (GRCm39) missense probably benign
R1758:Xdh UTSW 17 74,217,204 (GRCm39) missense probably damaging 1.00
R1951:Xdh UTSW 17 74,214,653 (GRCm39) missense probably damaging 1.00
R1969:Xdh UTSW 17 74,199,746 (GRCm39) missense possibly damaging 0.55
R2024:Xdh UTSW 17 74,228,300 (GRCm39) missense possibly damaging 0.92
R2080:Xdh UTSW 17 74,216,320 (GRCm39) missense probably damaging 1.00
R2157:Xdh UTSW 17 74,229,532 (GRCm39) missense probably damaging 1.00
R2300:Xdh UTSW 17 74,198,260 (GRCm39) missense probably damaging 1.00
R3783:Xdh UTSW 17 74,200,590 (GRCm39) splice site probably benign
R3796:Xdh UTSW 17 74,214,653 (GRCm39) missense probably damaging 1.00
R3797:Xdh UTSW 17 74,214,653 (GRCm39) missense probably damaging 1.00
R3798:Xdh UTSW 17 74,214,653 (GRCm39) missense probably damaging 1.00
R3799:Xdh UTSW 17 74,214,653 (GRCm39) missense probably damaging 1.00
R3819:Xdh UTSW 17 74,213,720 (GRCm39) missense probably benign 0.35
R4085:Xdh UTSW 17 74,223,874 (GRCm39) missense probably benign 0.35
R4240:Xdh UTSW 17 74,202,790 (GRCm39) missense possibly damaging 0.72
R4356:Xdh UTSW 17 74,222,685 (GRCm39) missense probably benign 0.01
R4522:Xdh UTSW 17 74,205,339 (GRCm39) missense probably damaging 1.00
R4523:Xdh UTSW 17 74,205,339 (GRCm39) missense probably damaging 1.00
R4524:Xdh UTSW 17 74,205,339 (GRCm39) missense probably damaging 1.00
R4617:Xdh UTSW 17 74,225,389 (GRCm39) missense probably damaging 0.99
R4756:Xdh UTSW 17 74,193,381 (GRCm39) missense probably benign 0.24
R4761:Xdh UTSW 17 74,217,262 (GRCm39) missense possibly damaging 0.91
R4815:Xdh UTSW 17 74,213,210 (GRCm39) missense probably damaging 1.00
R4850:Xdh UTSW 17 74,205,330 (GRCm39) missense probably damaging 1.00
R4896:Xdh UTSW 17 74,217,238 (GRCm39) missense probably damaging 0.96
R4897:Xdh UTSW 17 74,207,703 (GRCm39) missense probably benign
R4923:Xdh UTSW 17 74,231,931 (GRCm39) missense possibly damaging 0.72
R4977:Xdh UTSW 17 74,205,965 (GRCm39) missense probably benign 0.05
R5030:Xdh UTSW 17 74,198,288 (GRCm39) missense probably damaging 1.00
R5185:Xdh UTSW 17 74,232,006 (GRCm39) missense probably damaging 1.00
R5347:Xdh UTSW 17 74,232,027 (GRCm39) missense probably benign
R5556:Xdh UTSW 17 74,204,759 (GRCm39) missense probably benign 0.21
R5566:Xdh UTSW 17 74,200,617 (GRCm39) missense probably damaging 1.00
R5568:Xdh UTSW 17 74,250,880 (GRCm39) missense possibly damaging 0.90
R5635:Xdh UTSW 17 74,220,870 (GRCm39) missense possibly damaging 0.92
R5662:Xdh UTSW 17 74,248,110 (GRCm39) missense probably damaging 0.99
R5955:Xdh UTSW 17 74,205,315 (GRCm39) missense probably damaging 1.00
R6058:Xdh UTSW 17 74,213,264 (GRCm39) missense probably damaging 1.00
R6061:Xdh UTSW 17 74,228,342 (GRCm39) missense probably damaging 1.00
R6412:Xdh UTSW 17 74,242,902 (GRCm39) missense probably benign 0.09
R6526:Xdh UTSW 17 74,207,546 (GRCm39) missense probably damaging 0.97
R6558:Xdh UTSW 17 74,200,708 (GRCm39) missense possibly damaging 0.95
R6843:Xdh UTSW 17 74,230,125 (GRCm39) missense probably damaging 1.00
R6932:Xdh UTSW 17 74,229,557 (GRCm39) missense probably damaging 0.99
R7028:Xdh UTSW 17 74,250,868 (GRCm39) missense probably damaging 0.99
R7418:Xdh UTSW 17 74,220,960 (GRCm39) missense possibly damaging 0.81
R7503:Xdh UTSW 17 74,233,205 (GRCm39) missense probably damaging 1.00
R7653:Xdh UTSW 17 74,204,040 (GRCm39) missense probably benign 0.10
R7763:Xdh UTSW 17 74,241,829 (GRCm39) missense possibly damaging 0.69
R7768:Xdh UTSW 17 74,246,831 (GRCm39) missense probably benign
R7904:Xdh UTSW 17 74,229,467 (GRCm39) missense probably benign 0.09
R8010:Xdh UTSW 17 74,216,312 (GRCm39) nonsense probably null
R8067:Xdh UTSW 17 74,207,652 (GRCm39) missense probably benign 0.01
R8238:Xdh UTSW 17 74,193,412 (GRCm39) missense probably benign
R8253:Xdh UTSW 17 74,225,377 (GRCm39) missense possibly damaging 0.94
R8346:Xdh UTSW 17 74,220,938 (GRCm39) missense probably damaging 1.00
R8350:Xdh UTSW 17 74,241,837 (GRCm39) missense probably damaging 1.00
R8381:Xdh UTSW 17 74,219,456 (GRCm39) missense probably benign
R8427:Xdh UTSW 17 74,242,926 (GRCm39) missense probably damaging 1.00
R8465:Xdh UTSW 17 74,206,007 (GRCm39) nonsense probably null
R8478:Xdh UTSW 17 74,213,053 (GRCm39) missense probably benign 0.00
R8680:Xdh UTSW 17 74,229,500 (GRCm39) missense probably benign
R8802:Xdh UTSW 17 74,225,405 (GRCm39) missense probably benign 0.00
R8984:Xdh UTSW 17 74,228,346 (GRCm39) missense probably damaging 1.00
R8985:Xdh UTSW 17 74,228,346 (GRCm39) missense probably damaging 1.00
R8995:Xdh UTSW 17 74,205,369 (GRCm39) missense probably damaging 1.00
R9035:Xdh UTSW 17 74,217,222 (GRCm39) missense probably benign
R9149:Xdh UTSW 17 74,222,688 (GRCm39) missense probably benign
R9181:Xdh UTSW 17 74,232,006 (GRCm39) missense probably damaging 1.00
R9357:Xdh UTSW 17 74,233,541 (GRCm39) critical splice donor site probably null
R9357:Xdh UTSW 17 74,214,711 (GRCm39) missense probably damaging 0.97
R9609:Xdh UTSW 17 74,231,990 (GRCm39) missense possibly damaging 0.91
R9803:Xdh UTSW 17 74,229,455 (GRCm39) missense probably benign
X0019:Xdh UTSW 17 74,225,449 (GRCm39) missense probably damaging 1.00
Z1088:Xdh UTSW 17 74,193,423 (GRCm39) missense probably benign
Z1176:Xdh UTSW 17 74,230,037 (GRCm39) critical splice donor site probably null
Z1177:Xdh UTSW 17 74,204,690 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGGGAAGCTGCTGTCAACTG -3'
(R):5'- GCTAAGTTCTTGTGAGAGGCTC -3'

Sequencing Primer
(F):5'- AAGCTGCTGTCAACTGTAGTC -3'
(R):5'- CCTAAAATGTGCTTTGACCAAAGGG -3'
Posted On 2015-09-25