Incidental Mutation 'R4600:Xdh'
ID345581
Institutional Source Beutler Lab
Gene Symbol Xdh
Ensembl Gene ENSMUSG00000024066
Gene Namexanthine dehydrogenase
Synonymsxanthine oxidase, XO, Xor, Xox1, Xox-1
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.386) question?
Stock #R4600 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location73883908-73950182 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 73910200 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Asparagine at position 691 (T691N)
Ref Sequence ENSEMBL: ENSMUSP00000024866 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024866]
Predicted Effect probably benign
Transcript: ENSMUST00000024866
AA Change: T691N

PolyPhen 2 Score 0.194 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000024866
Gene: ENSMUSG00000024066
AA Change: T691N

DomainStartEndE-ValueType
Pfam:Fer2 11 81 5e-12 PFAM
Pfam:Fer2_2 90 163 4.1e-31 PFAM
low complexity region 169 182 N/A INTRINSIC
Pfam:FAD_binding_5 234 414 4.9e-47 PFAM
CO_deh_flav_C 421 525 1.16e-24 SMART
Ald_Xan_dh_C 590 696 1.23e-46 SMART
Pfam:Ald_Xan_dh_C2 704 1239 1e-200 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the xanthine dehydrogenase protein family. The encoded protein has been identified as a moonlighting protein based on its ability to perform mechanistically distinct functions. The encoded protein exists as two distinct enzymatic forms, either as xanthine dehydrogenase, or as xanthine oxidase, and functions in purine degradation. Additional studies also suggest a role in adipogenesis, and a function as a structural protein in milk fat droplets in the lactating mammary gland. [provided by RefSeq, Jan 2014]
PHENOTYPE: Homozygotes for a null allele are small and die prematurely while heterozygous females show a lactation defect. Most homozygotes for another null allele die within the first month of renal failure associated with uric acid depletion, renal tubular damage, inflammation, fibrosis and oxidative stress. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 94 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700029J07Rik A T 8: 45,970,468 I69N probably damaging Het
2700049A03Rik T C 12: 71,148,263 F145L possibly damaging Het
Aars2 T A 17: 45,516,921 D555E probably damaging Het
Ago1 C A 4: 126,460,392 M208I probably benign Het
Ak7 G A 12: 105,713,575 V123M probably benign Het
Amfr A G 8: 93,974,221 L537P probably damaging Het
Apob A G 12: 8,008,568 D2317G probably damaging Het
Asb6 T A 2: 30,824,471 D209V probably damaging Het
AY358078 T A 14: 51,826,075 C393S possibly damaging Het
Baz2a T A 10: 128,121,183 C932S probably damaging Het
BC067074 A G 13: 113,319,249 R610G possibly damaging Het
Btnl10 A G 11: 58,923,600 I369V probably benign Het
Ccdc66 T C 14: 27,500,420 N122S probably damaging Het
Clic4 A T 4: 135,238,989 probably null Het
Col6a3 A G 1: 90,781,904 S1857P unknown Het
Cracr2a A C 6: 127,603,888 D9A probably benign Het
Dcst1 T C 3: 89,356,336 E384G probably benign Het
Ddx4 T C 13: 112,612,060 K435E probably damaging Het
Deaf1 T A 7: 141,310,971 T433S possibly damaging Het
Dnah3 T A 7: 120,089,946 M82L probably benign Het
Dnhd1 G T 7: 105,703,644 R2668L probably damaging Het
Efcab6 C T 15: 83,946,925 G596D probably benign Het
Ercc3 G A 18: 32,245,571 A202T probably benign Het
Fam181b C A 7: 93,080,784 A255E possibly damaging Het
Fam83e T A 7: 45,723,500 D178E probably benign Het
Frem2 A G 3: 53,547,807 L2116S possibly damaging Het
Gm16494 T A 17: 47,016,797 K54* probably null Het
Golgb1 A G 16: 36,918,625 D2442G probably damaging Het
Greb1l G A 18: 10,553,705 A1569T probably damaging Het
Grik5 C G 7: 25,068,064 E64Q probably damaging Het
Gstm5 A G 3: 107,897,986 Y130C probably damaging Het
Gucy2e C G 11: 69,236,168 A160P possibly damaging Het
Hydin A T 8: 110,566,950 T3510S probably benign Het
Itgb2 A G 10: 77,546,115 I84V probably benign Het
Itsn1 A G 16: 91,899,587 Q26R probably damaging Het
Kat6a A G 8: 22,939,311 S1561G probably benign Het
Khnyn G A 14: 55,886,981 V231I probably benign Het
Kif21b A G 1: 136,147,864 D243G probably benign Het
Klk4 T A 7: 43,885,338 N240K probably damaging Het
Knl1 T C 2: 119,070,544 S909P possibly damaging Het
Lamb1 A C 12: 31,323,529 D1419A probably benign Het
Lin9 T A 1: 180,681,194 V421D probably damaging Het
Lipt2 T C 7: 100,160,312 L202P probably benign Het
Mbd5 T G 2: 49,257,197 M473R probably benign Het
Mcc A T 18: 44,519,520 I279N probably damaging Het
Mcpt9 C T 14: 56,028,592 V60M probably damaging Het
Mrc2 G A 11: 105,348,431 probably null Het
Mslnl G A 17: 25,742,934 V128M probably damaging Het
Mylk2 G A 2: 152,917,556 V389M probably damaging Het
Ndufs7 T A 10: 80,256,667 Y203* probably null Het
Nup160 T A 2: 90,685,197 probably null Het
Nup88 G A 11: 70,969,696 R62* probably null Het
Olfr130 T C 17: 38,067,962 S264P probably damaging Het
Olfr145 T A 9: 37,898,326 S307R probably benign Het
Olfr609 T A 7: 103,492,581 Q99L probably damaging Het
Olfr777 G A 10: 129,268,405 A306V probably benign Het
Olfr952 A G 9: 39,426,435 M212T probably benign Het
Os9 T C 10: 127,098,354 N471S probably benign Het
Otof C T 5: 30,371,900 V1757M probably damaging Het
Pald1 T C 10: 61,348,616 T241A probably benign Het
Palm2 A T 4: 57,709,954 T300S probably benign Het
Pappa2 G A 1: 158,814,445 S1347L probably damaging Het
Pccb T C 9: 101,034,779 T27A probably benign Het
Pde4dip A T 3: 97,695,944 V2243D probably damaging Het
Pkd2l2 C A 18: 34,438,201 Q590K probably benign Het
Pmepa1 G A 2: 173,228,327 P145L possibly damaging Het
Ppp3cb T C 14: 20,520,646 N339S possibly damaging Het
Rnf133 T C 6: 23,649,042 E296G possibly damaging Het
Secisbp2l C T 2: 125,740,737 G933D possibly damaging Het
Serpinb12 T A 1: 106,949,153 D66E probably benign Het
Slc35e2 T C 4: 155,617,649 F290S probably benign Het
Slc46a2 C T 4: 59,911,886 C442Y probably damaging Het
Slc7a1 A G 5: 148,342,059 L301P probably damaging Het
Spg21 A G 9: 65,475,975 T148A probably benign Het
Stox2 A G 8: 47,192,935 S497P probably damaging Het
Sult1c1 C A 17: 53,973,955 W40L probably benign Het
Sytl2 T C 7: 90,375,769 S322P probably benign Het
Telo2 C A 17: 25,105,148 R531L possibly damaging Het
Thbs3 T C 3: 89,224,590 V719A probably damaging Het
Tlr9 T A 9: 106,224,533 L341Q probably damaging Het
Tmprss5 A G 9: 49,113,248 N230D possibly damaging Het
Tns2 C T 15: 102,108,934 R281C probably damaging Het
Tpo C T 12: 30,098,229 V558M probably benign Het
Trex1 T G 9: 109,058,284 Q213P possibly damaging Het
Ttc30a1 T C 2: 75,980,633 T369A probably benign Het
Ttc7b G A 12: 100,500,117 R79C probably damaging Het
Ugt1a6a A G 1: 88,138,864 K131E probably benign Het
Vipr1 T A 9: 121,665,136 probably null Het
Vmn1r22 T C 6: 57,900,875 D39G probably damaging Het
Vmn2r58 A T 7: 41,872,622 C17S probably benign Het
Vps41 T C 13: 18,745,283 Y63H probably damaging Het
Zfp518b T C 5: 38,673,627 N345S probably damaging Het
Zfp536 T A 7: 37,568,493 K499N probably damaging Het
Zfp963 A T 8: 69,742,860 probably null Het
Other mutations in Xdh
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00493:Xdh APN 17 73923106 missense possibly damaging 0.58
IGL00556:Xdh APN 17 73884435 makesense probably null
IGL01524:Xdh APN 17 73923137 critical splice acceptor site probably null
IGL01604:Xdh APN 17 73909337 missense probably benign 0.02
IGL01625:Xdh APN 17 73916786 critical splice donor site probably null
IGL01778:Xdh APN 17 73900280 missense probably benign 0.00
IGL01804:Xdh APN 17 73892759 missense probably damaging 1.00
IGL01825:Xdh APN 17 73891245 missense probably damaging 1.00
IGL01929:Xdh APN 17 73934855 missense probably damaging 1.00
IGL02068:Xdh APN 17 73913950 missense probably damaging 1.00
IGL02079:Xdh APN 17 73891277 missense probably damaging 1.00
IGL02210:Xdh APN 17 73943895 missense probably benign 0.00
IGL02261:Xdh APN 17 73913965 missense possibly damaging 0.81
IGL02365:Xdh APN 17 73943890 missense probably benign 0.14
IGL02424:Xdh APN 17 73926570 missense probably benign 0.00
IGL02491:Xdh APN 17 73886464 missense probably damaging 0.99
IGL02525:Xdh APN 17 73924995 missense possibly damaging 0.91
IGL02578:Xdh APN 17 73906246 missense probably damaging 1.00
IGL02793:Xdh APN 17 73900581 missense probably damaging 1.00
IGL02939:Xdh APN 17 73943845 critical splice donor site probably null
IGL03327:Xdh APN 17 73916792 missense probably benign
IGL03345:Xdh APN 17 73906032 missense probably damaging 0.98
IGL03353:Xdh APN 17 73895786 missense possibly damaging 0.65
R0018:Xdh UTSW 17 73925025 missense probably benign 0.00
R0018:Xdh UTSW 17 73925025 missense probably benign 0.00
R0033:Xdh UTSW 17 73907632 missense probably benign 0.06
R0079:Xdh UTSW 17 73891218 missense probably damaging 1.00
R0086:Xdh UTSW 17 73884438 missense probably benign
R0319:Xdh UTSW 17 73906101 splice site probably benign
R0336:Xdh UTSW 17 73922463 missense possibly damaging 0.91
R0389:Xdh UTSW 17 73898362 missense probably damaging 1.00
R0684:Xdh UTSW 17 73943891 missense probably damaging 0.97
R0930:Xdh UTSW 17 73923082 missense probably benign 0.00
R1073:Xdh UTSW 17 73939836 missense probably benign
R1114:Xdh UTSW 17 73941149 splice site probably benign
R1201:Xdh UTSW 17 73918418 missense probably benign 0.05
R1230:Xdh UTSW 17 73891256 missense probably damaging 1.00
R1351:Xdh UTSW 17 73923078 missense probably benign 0.02
R1470:Xdh UTSW 17 73891112 missense probably damaging 1.00
R1470:Xdh UTSW 17 73891112 missense probably damaging 1.00
R1485:Xdh UTSW 17 73914019 nonsense probably null
R1548:Xdh UTSW 17 73913901 missense probably damaging 0.98
R1637:Xdh UTSW 17 73900578 missense probably benign
R1641:Xdh UTSW 17 73926552 missense probably benign
R1758:Xdh UTSW 17 73910209 missense probably damaging 1.00
R1951:Xdh UTSW 17 73907658 missense probably damaging 1.00
R1969:Xdh UTSW 17 73892751 missense possibly damaging 0.55
R2024:Xdh UTSW 17 73921305 missense possibly damaging 0.92
R2080:Xdh UTSW 17 73909325 missense probably damaging 1.00
R2157:Xdh UTSW 17 73922537 missense probably damaging 1.00
R2300:Xdh UTSW 17 73891265 missense probably damaging 1.00
R3783:Xdh UTSW 17 73893595 splice site probably benign
R3796:Xdh UTSW 17 73907658 missense probably damaging 1.00
R3797:Xdh UTSW 17 73907658 missense probably damaging 1.00
R3798:Xdh UTSW 17 73907658 missense probably damaging 1.00
R3799:Xdh UTSW 17 73907658 missense probably damaging 1.00
R3819:Xdh UTSW 17 73906725 missense probably benign 0.35
R4085:Xdh UTSW 17 73916879 missense probably benign 0.35
R4240:Xdh UTSW 17 73895795 missense possibly damaging 0.72
R4356:Xdh UTSW 17 73915690 missense probably benign 0.01
R4522:Xdh UTSW 17 73898344 missense probably damaging 1.00
R4523:Xdh UTSW 17 73898344 missense probably damaging 1.00
R4524:Xdh UTSW 17 73898344 missense probably damaging 1.00
R4617:Xdh UTSW 17 73918394 missense probably damaging 0.99
R4756:Xdh UTSW 17 73886386 missense probably benign 0.24
R4761:Xdh UTSW 17 73910267 missense possibly damaging 0.91
R4815:Xdh UTSW 17 73906215 missense probably damaging 1.00
R4850:Xdh UTSW 17 73898335 missense probably damaging 1.00
R4896:Xdh UTSW 17 73910243 missense probably damaging 0.96
R4897:Xdh UTSW 17 73900708 missense probably benign
R4923:Xdh UTSW 17 73924936 missense possibly damaging 0.72
R4977:Xdh UTSW 17 73898970 missense probably benign 0.05
R5030:Xdh UTSW 17 73891293 missense probably damaging 1.00
R5185:Xdh UTSW 17 73925011 missense probably damaging 1.00
R5347:Xdh UTSW 17 73925032 missense probably benign
R5556:Xdh UTSW 17 73897764 missense probably benign 0.21
R5566:Xdh UTSW 17 73893622 missense probably damaging 1.00
R5568:Xdh UTSW 17 73943885 missense possibly damaging 0.90
R5635:Xdh UTSW 17 73913875 missense possibly damaging 0.92
R5662:Xdh UTSW 17 73941115 missense probably damaging 0.99
R5955:Xdh UTSW 17 73898320 missense probably damaging 1.00
R6058:Xdh UTSW 17 73906269 missense probably damaging 1.00
R6061:Xdh UTSW 17 73921347 missense probably damaging 1.00
R6412:Xdh UTSW 17 73935907 missense probably benign 0.09
R6526:Xdh UTSW 17 73900551 missense probably damaging 0.97
R6558:Xdh UTSW 17 73893713 missense possibly damaging 0.95
R6843:Xdh UTSW 17 73923130 missense probably damaging 1.00
R6932:Xdh UTSW 17 73922562 missense probably damaging 0.99
R7028:Xdh UTSW 17 73943873 missense probably damaging 0.99
R7418:Xdh UTSW 17 73913965 missense possibly damaging 0.81
R7503:Xdh UTSW 17 73926210 missense probably damaging 1.00
R7653:Xdh UTSW 17 73897045 missense probably benign 0.10
R7763:Xdh UTSW 17 73934834 missense possibly damaging 0.69
R7768:Xdh UTSW 17 73939836 missense probably benign
R7904:Xdh UTSW 17 73922472 missense probably benign 0.09
R8010:Xdh UTSW 17 73909317 nonsense probably null
R8067:Xdh UTSW 17 73900657 missense probably benign 0.01
R8238:Xdh UTSW 17 73886417 missense probably benign
R8253:Xdh UTSW 17 73918382 missense possibly damaging 0.94
R8346:Xdh UTSW 17 73913943 missense probably damaging 1.00
R8381:Xdh UTSW 17 73912461 missense probably benign
R8427:Xdh UTSW 17 73935931 missense probably damaging 1.00
X0019:Xdh UTSW 17 73918454 missense probably damaging 1.00
Z1088:Xdh UTSW 17 73886428 missense probably benign
Z1176:Xdh UTSW 17 73923042 critical splice donor site probably null
Z1177:Xdh UTSW 17 73897695 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGGGAAGCTGCTGTCAACTG -3'
(R):5'- GCTAAGTTCTTGTGAGAGGCTC -3'

Sequencing Primer
(F):5'- AAGCTGCTGTCAACTGTAGTC -3'
(R):5'- CCTAAAATGTGCTTTGACCAAAGGG -3'
Posted On2015-09-25