Incidental Mutation 'R4601:Fam160a1'
ID345605
Institutional Source Beutler Lab
Gene Symbol Fam160a1
Ensembl Gene ENSMUSG00000051000
Gene Namefamily with sequence similarity 160, member A1
Synonyms9930021J17Rik
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4601 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location85660061-85817291 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 85741180 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Valine at position 26 (M26V)
Ref Sequence ENSEMBL: ENSMUSP00000113235 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094148] [ENSMUST00000118408] [ENSMUST00000119077] [ENSMUST00000154148]
Predicted Effect probably damaging
Transcript: ENSMUST00000094148
AA Change: M26V

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000091700
Gene: ENSMUSG00000051000
AA Change: M26V

DomainStartEndE-ValueType
Pfam:RAI16-like 88 411 1.2e-102 PFAM
low complexity region 483 500 N/A INTRINSIC
low complexity region 613 622 N/A INTRINSIC
low complexity region 838 853 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000118408
AA Change: M26V

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000113235
Gene: ENSMUSG00000051000
AA Change: M26V

DomainStartEndE-ValueType
Pfam:RAI16-like 88 411 1.1e-98 PFAM
low complexity region 483 500 N/A INTRINSIC
low complexity region 613 622 N/A INTRINSIC
low complexity region 838 853 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000119077
SMART Domains Protein: ENSMUSP00000112705
Gene: ENSMUSG00000051000

DomainStartEndE-ValueType
low complexity region 67 84 N/A INTRINSIC
low complexity region 197 206 N/A INTRINSIC
low complexity region 422 437 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000154148
SMART Domains Protein: ENSMUSP00000116393
Gene: ENSMUSG00000102805

DomainStartEndE-ValueType
Arfaptin 1 227 7.15e-121 SMART
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.1%
  • 20x: 94.5%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 91 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700029J07Rik A T 8: 45,970,468 I69N probably damaging Het
4930435E12Rik A G 16: 38,828,018 V243A probably benign Het
Aars2 T A 17: 45,516,921 D555E probably damaging Het
Abca16 T G 7: 120,436,697 F334L probably damaging Het
Abcc4 T A 14: 118,632,163 M186L probably benign Het
Agap3 T C 5: 24,476,408 L120P probably damaging Het
Ak7 G A 12: 105,713,575 V123M probably benign Het
Aldh1a7 A T 19: 20,715,979 V192D probably damaging Het
Ankrd36 A G 11: 5,570,102 D59G probably benign Het
Arsi G A 18: 60,916,651 G202E probably benign Het
Cacna1e A G 1: 154,471,613 V936A probably benign Het
Camkv T C 9: 107,946,096 V107A probably damaging Het
Camp T C 9: 109,848,662 E80G probably damaging Het
Ccdc66 T C 14: 27,500,420 N122S probably damaging Het
Cd101 G A 3: 100,993,888 T960M possibly damaging Het
Cdk18 A G 1: 132,116,919 V323A possibly damaging Het
Celf2 G T 2: 6,586,020 N279K possibly damaging Het
Cemip T C 7: 83,951,618 I932V probably damaging Het
Cep250 C A 2: 155,962,053 Q28K probably benign Het
Ces2f T C 8: 104,949,964 C97R probably damaging Het
Cfap126 G T 1: 171,114,058 G41C possibly damaging Het
Chat T C 14: 32,424,155 M354V probably benign Het
Clca4b A T 3: 144,927,184 D168E possibly damaging Het
Cpxm1 T A 2: 130,393,576 M499L possibly damaging Het
Dennd3 T A 15: 73,567,160 W1126R probably damaging Het
Dgkb T C 12: 38,602,820 S735P probably damaging Het
Dlec1 T C 9: 119,147,134 probably null Het
Dnajc6 T C 4: 101,611,264 F166L probably damaging Het
Dph5 A G 3: 115,899,777 N115D possibly damaging Het
Ercc3 G A 18: 32,245,571 A202T probably benign Het
Erich3 A T 3: 154,764,738 D136V unknown Het
Exoc2 T C 13: 30,882,268 N475S probably benign Het
Fam217a T C 13: 34,911,302 D310G probably damaging Het
Fam53a C T 5: 33,600,663 S372N probably benign Het
Fbn2 C G 18: 58,053,733 G1699R probably damaging Het
Fbxo46 T C 7: 19,135,564 V36A probably benign Het
G6pc A G 11: 101,372,741 Y127C probably damaging Het
Gba2 A G 4: 43,573,810 F161L probably damaging Het
Gif A C 19: 11,752,190 D171A probably damaging Het
Gja1 T C 10: 56,388,229 L228P probably damaging Het
Gm20834 A G Y: 10,323,178 V86A probably benign Het
Hmcn1 A T 1: 150,738,645 C1337S probably damaging Het
Il1rl1 T A 1: 40,441,300 S30T possibly damaging Het
Itgb4 A G 11: 116,005,722 T1436A probably damaging Het
Itk T A 11: 46,336,515 Q427L probably benign Het
Klhdc4 T C 8: 121,799,527 E291G probably damaging Het
Map4 T A 9: 110,052,819 S250R possibly damaging Het
Mnt T A 11: 74,836,459 V57E possibly damaging Het
Mrc2 G A 11: 105,348,431 probably null Het
Mslnl G A 17: 25,742,934 V128M probably damaging Het
Musk A T 4: 58,301,625 I128F probably damaging Het
Myh4 G A 11: 67,250,310 A733T possibly damaging Het
Myo5a T A 9: 75,136,388 F220I probably damaging Het
Npas3 A G 12: 54,044,578 H305R probably damaging Het
Nrcam A T 12: 44,591,056 Y1132F probably damaging Het
Nt5c3b A C 11: 100,432,918 D189E probably benign Het
Nuf2 A G 1: 169,506,114 L331P probably damaging Het
Nup214 C T 2: 31,997,965 T646I probably benign Het
Olfr112 T C 17: 37,564,185 N42S probably damaging Het
Pcdh18 T C 3: 49,744,725 E1096G probably damaging Het
Pgm1 T A 5: 64,107,727 F364I probably benign Het
Pikfyve A G 1: 65,234,262 N612S probably damaging Het
Pla2g4e T G 2: 120,186,382 H226P possibly damaging Het
Ppp3cb T C 14: 20,520,646 N339S possibly damaging Het
Prkd2 G T 7: 16,843,648 probably benign Het
Rnf133 T C 6: 23,649,042 E296G possibly damaging Het
Sav1 A T 12: 69,984,321 D142E probably benign Het
Scn3b C A 9: 40,288,423 P212T probably damaging Het
Sel1l A T 12: 91,833,053 probably null Het
Sept9 A G 11: 117,360,484 K543E probably damaging Het
Serpinb12 T A 1: 106,949,153 D66E probably benign Het
Slc35e2 T C 4: 155,617,649 F290S probably benign Het
Snrpa A G 7: 27,195,533 M1T probably null Het
Soga1 T C 2: 157,039,924 K736R probably benign Het
Sptlc3 G A 2: 139,636,680 V520I probably benign Het
Srpk3 A G X: 73,774,941 H79R possibly damaging Het
Stox2 A G 8: 47,192,935 S497P probably damaging Het
Stradb G A 1: 58,993,572 S361N probably damaging Het
Sult3a2 T C 10: 33,782,087 K10R probably benign Het
Susd4 A G 1: 182,858,460 N192D probably damaging Het
Tcp10a T A 17: 7,325,975 D32E probably benign Het
Tdpoz4 T A 3: 93,797,032 V212D probably damaging Het
Tdrd5 T A 1: 156,284,374 T479S probably benign Het
Tex10 T C 4: 48,452,946 D671G probably benign Het
Traj37 T C 14: 54,181,539 probably benign Het
Ttc7b G A 12: 100,500,117 R79C probably damaging Het
Vmn2r115 T A 17: 23,346,399 L420Q probably benign Het
Wdr24 T A 17: 25,828,207 probably null Het
Wdr81 T A 11: 75,445,658 Q516L probably damaging Het
Zfp516 A G 18: 82,956,039 T121A probably benign Het
Zmat1 A T X: 134,972,945 S566T probably damaging Homo
Other mutations in Fam160a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00588:Fam160a1 APN 3 85672618 missense probably benign 0.01
IGL01102:Fam160a1 APN 3 85665501 intron probably benign
IGL01317:Fam160a1 APN 3 85672846 missense probably benign 0.01
IGL01759:Fam160a1 APN 3 85688447 missense probably damaging 1.00
IGL02007:Fam160a1 APN 3 85722445 missense probably damaging 1.00
IGL02037:Fam160a1 APN 3 85730632 missense probably damaging 0.99
IGL02163:Fam160a1 APN 3 85688552 missense possibly damaging 0.92
IGL02192:Fam160a1 APN 3 85673326 missense possibly damaging 0.82
IGL02617:Fam160a1 APN 3 85673037 missense probably benign 0.00
PIT4378001:Fam160a1 UTSW 3 85730551 missense probably damaging 1.00
PIT4520001:Fam160a1 UTSW 3 85672472 nonsense probably null
PIT4651001:Fam160a1 UTSW 3 85683641 missense probably damaging 1.00
R0590:Fam160a1 UTSW 3 85672376 missense probably benign 0.13
R0625:Fam160a1 UTSW 3 85730500 missense possibly damaging 0.84
R0648:Fam160a1 UTSW 3 85730614 missense probably damaging 1.00
R0931:Fam160a1 UTSW 3 85673243 missense probably benign
R0940:Fam160a1 UTSW 3 85665490 missense possibly damaging 0.92
R0941:Fam160a1 UTSW 3 85673059 missense probably benign 0.03
R1115:Fam160a1 UTSW 3 85722495 missense probably benign 0.02
R1161:Fam160a1 UTSW 3 85672468 missense probably damaging 0.96
R1460:Fam160a1 UTSW 3 85730876 missense probably damaging 1.00
R1503:Fam160a1 UTSW 3 85672477 missense possibly damaging 0.70
R1545:Fam160a1 UTSW 3 85665954 missense probably damaging 1.00
R1820:Fam160a1 UTSW 3 85665829 missense probably damaging 1.00
R1907:Fam160a1 UTSW 3 85672633 missense probably benign 0.00
R1911:Fam160a1 UTSW 3 85661218 missense probably benign 0.12
R1928:Fam160a1 UTSW 3 85688531 missense probably damaging 1.00
R2200:Fam160a1 UTSW 3 85730321 missense probably damaging 1.00
R2235:Fam160a1 UTSW 3 85661101 missense probably damaging 0.97
R2373:Fam160a1 UTSW 3 85676097 nonsense probably null
R3084:Fam160a1 UTSW 3 85665968 critical splice acceptor site probably null
R4125:Fam160a1 UTSW 3 85665383 missense possibly damaging 0.87
R4612:Fam160a1 UTSW 3 85730372 nonsense probably null
R4665:Fam160a1 UTSW 3 85730681 missense probably damaging 1.00
R4673:Fam160a1 UTSW 3 85730713 missense probably damaging 1.00
R4707:Fam160a1 UTSW 3 85688570 missense probably damaging 1.00
R4783:Fam160a1 UTSW 3 85688570 missense probably damaging 1.00
R4785:Fam160a1 UTSW 3 85688570 missense probably damaging 1.00
R4825:Fam160a1 UTSW 3 85673432 missense possibly damaging 0.93
R4884:Fam160a1 UTSW 3 85683611 missense probably damaging 1.00
R5653:Fam160a1 UTSW 3 85722501 missense probably damaging 1.00
R5663:Fam160a1 UTSW 3 85672433 missense probably benign
R5764:Fam160a1 UTSW 3 85665865 missense probably damaging 1.00
R6134:Fam160a1 UTSW 3 85673344 missense possibly damaging 0.93
R6284:Fam160a1 UTSW 3 85672688 missense probably benign 0.01
R6789:Fam160a1 UTSW 3 85672558 nonsense probably null
R6843:Fam160a1 UTSW 3 85673045 missense probably damaging 0.96
R7305:Fam160a1 UTSW 3 85730524 missense probably damaging 1.00
R7406:Fam160a1 UTSW 3 85730477 missense probably benign 0.13
R7448:Fam160a1 UTSW 3 85672564 missense probably benign 0.00
R7469:Fam160a1 UTSW 3 85672762 missense probably benign 0.00
R7578:Fam160a1 UTSW 3 85665898 missense probably damaging 0.99
R7707:Fam160a1 UTSW 3 85676253 missense probably benign 0.21
Predicted Primers PCR Primer
(F):5'- TACACACTGTTGGAAATCAGGAG -3'
(R):5'- GGTTTTGGAAAATGACCATGAAGACTG -3'

Sequencing Primer
(F):5'- CTGTTGGAAATCAGGAGGGAAAAGC -3'
(R):5'- TGACCATGAAGACTGAAGAAATTAC -3'
Posted On2015-09-25