Incidental Mutation 'R4601:Dnajc6'
ID345617
Institutional Source Beutler Lab
Gene Symbol Dnajc6
Ensembl Gene ENSMUSG00000028528
Gene NameDnaJ heat shock protein family (Hsp40) member C6
Synonymsauxilin, 2810027M23Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.113) question?
Stock #R4601 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location101496648-101642799 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 101611264 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 166 (F166L)
Ref Sequence ENSEMBL: ENSMUSP00000102543 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038207] [ENSMUST00000094953] [ENSMUST00000106929] [ENSMUST00000106930] [ENSMUST00000106933] [ENSMUST00000149047] [ENSMUST00000154120]
Predicted Effect probably damaging
Transcript: ENSMUST00000038207
AA Change: F204L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000044251
Gene: ENSMUSG00000028528
AA Change: F204L

DomainStartEndE-ValueType
SCOP:d1d5ra2 88 244 1e-20 SMART
PTEN_C2 251 390 5.95e-42 SMART
low complexity region 502 521 N/A INTRINSIC
low complexity region 554 569 N/A INTRINSIC
low complexity region 679 694 N/A INTRINSIC
low complexity region 719 735 N/A INTRINSIC
low complexity region 829 840 N/A INTRINSIC
DnaJ 873 934 2e-4 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000094953
AA Change: F166L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000092560
Gene: ENSMUSG00000028528
AA Change: F166L

DomainStartEndE-ValueType
SCOP:d1d5ra2 50 206 2e-20 SMART
PTEN_C2 213 352 5.95e-42 SMART
low complexity region 464 483 N/A INTRINSIC
low complexity region 516 531 N/A INTRINSIC
low complexity region 641 656 N/A INTRINSIC
low complexity region 681 697 N/A INTRINSIC
low complexity region 791 802 N/A INTRINSIC
DnaJ 835 896 2e-4 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000106929
AA Change: F166L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000102542
Gene: ENSMUSG00000028528
AA Change: F166L

DomainStartEndE-ValueType
SCOP:d1d5ra2 50 206 2e-20 SMART
PTEN_C2 213 352 5.95e-42 SMART
low complexity region 464 483 N/A INTRINSIC
low complexity region 516 531 N/A INTRINSIC
low complexity region 641 656 N/A INTRINSIC
low complexity region 681 697 N/A INTRINSIC
low complexity region 791 802 N/A INTRINSIC
DnaJ 835 896 2e-4 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000106930
AA Change: F166L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000102543
Gene: ENSMUSG00000028528
AA Change: F166L

DomainStartEndE-ValueType
SCOP:d1d5ra2 50 206 2e-20 SMART
PTEN_C2 213 352 5.95e-42 SMART
low complexity region 464 483 N/A INTRINSIC
low complexity region 516 531 N/A INTRINSIC
low complexity region 641 656 N/A INTRINSIC
low complexity region 681 697 N/A INTRINSIC
low complexity region 791 802 N/A INTRINSIC
DnaJ 835 896 2e-4 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000106933
AA Change: F234L

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000102546
Gene: ENSMUSG00000028528
AA Change: F234L

DomainStartEndE-ValueType
low complexity region 30 44 N/A INTRINSIC
SCOP:d1d5ra2 118 274 1e-20 SMART
PTEN_C2 281 420 5.95e-42 SMART
low complexity region 532 551 N/A INTRINSIC
low complexity region 584 599 N/A INTRINSIC
low complexity region 709 724 N/A INTRINSIC
low complexity region 749 765 N/A INTRINSIC
low complexity region 859 870 N/A INTRINSIC
DnaJ 903 964 2e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000149047
AA Change: F166L

PolyPhen 2 Score 0.090 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000119542
Gene: ENSMUSG00000028528
AA Change: F166L

DomainStartEndE-ValueType
PDB:3N0A|A 30 194 1e-118 PDB
SCOP:d1d5ra2 50 187 2e-17 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000154120
SMART Domains Protein: ENSMUSP00000114840
Gene: ENSMUSG00000028528

DomainStartEndE-ValueType
PDB:3N0A|A 30 116 4e-54 PDB
SCOP:d1d5ra2 50 101 1e-4 SMART
Meta Mutation Damage Score 0.1234 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.1%
  • 20x: 94.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] DNAJC6 belongs to the evolutionarily conserved DNAJ/HSP40 family of proteins, which regulate molecular chaperone activity by stimulating ATPase activity. DNAJ proteins may have up to 3 distinct domains: a conserved 70-amino acid J domain, usually at the N terminus, a glycine/phenylalanine (G/F)-rich region, and a cysteine-rich domain containing 4 motifs resembling a zinc finger domain (Ohtsuka and Hata, 2000 [PubMed 11147971]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Mice homozygous and heterozygous for a knock-out allele exhibit postnatal lethality and decreased body weight with homozygotes exhibiting decreased synpatic vesicle recycling. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 91 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700029J07Rik A T 8: 45,970,468 I69N probably damaging Het
4930435E12Rik A G 16: 38,828,018 V243A probably benign Het
Aars2 T A 17: 45,516,921 D555E probably damaging Het
Abca16 T G 7: 120,436,697 F334L probably damaging Het
Abcc4 T A 14: 118,632,163 M186L probably benign Het
Agap3 T C 5: 24,476,408 L120P probably damaging Het
Ak7 G A 12: 105,713,575 V123M probably benign Het
Aldh1a7 A T 19: 20,715,979 V192D probably damaging Het
Ankrd36 A G 11: 5,570,102 D59G probably benign Het
Arsi G A 18: 60,916,651 G202E probably benign Het
Cacna1e A G 1: 154,471,613 V936A probably benign Het
Camkv T C 9: 107,946,096 V107A probably damaging Het
Camp T C 9: 109,848,662 E80G probably damaging Het
Ccdc66 T C 14: 27,500,420 N122S probably damaging Het
Cd101 G A 3: 100,993,888 T960M possibly damaging Het
Cdk18 A G 1: 132,116,919 V323A possibly damaging Het
Celf2 G T 2: 6,586,020 N279K possibly damaging Het
Cemip T C 7: 83,951,618 I932V probably damaging Het
Cep250 C A 2: 155,962,053 Q28K probably benign Het
Ces2f T C 8: 104,949,964 C97R probably damaging Het
Cfap126 G T 1: 171,114,058 G41C possibly damaging Het
Chat T C 14: 32,424,155 M354V probably benign Het
Clca4b A T 3: 144,927,184 D168E possibly damaging Het
Cpxm1 T A 2: 130,393,576 M499L possibly damaging Het
Dennd3 T A 15: 73,567,160 W1126R probably damaging Het
Dgkb T C 12: 38,602,820 S735P probably damaging Het
Dlec1 T C 9: 119,147,134 probably null Het
Dph5 A G 3: 115,899,777 N115D possibly damaging Het
Ercc3 G A 18: 32,245,571 A202T probably benign Het
Erich3 A T 3: 154,764,738 D136V unknown Het
Exoc2 T C 13: 30,882,268 N475S probably benign Het
Fam160a1 T C 3: 85,741,180 M26V probably damaging Het
Fam217a T C 13: 34,911,302 D310G probably damaging Het
Fam53a C T 5: 33,600,663 S372N probably benign Het
Fbn2 C G 18: 58,053,733 G1699R probably damaging Het
Fbxo46 T C 7: 19,135,564 V36A probably benign Het
G6pc A G 11: 101,372,741 Y127C probably damaging Het
Gba2 A G 4: 43,573,810 F161L probably damaging Het
Gif A C 19: 11,752,190 D171A probably damaging Het
Gja1 T C 10: 56,388,229 L228P probably damaging Het
Gm20834 A G Y: 10,323,178 V86A probably benign Het
Hmcn1 A T 1: 150,738,645 C1337S probably damaging Het
Il1rl1 T A 1: 40,441,300 S30T possibly damaging Het
Itgb4 A G 11: 116,005,722 T1436A probably damaging Het
Itk T A 11: 46,336,515 Q427L probably benign Het
Klhdc4 T C 8: 121,799,527 E291G probably damaging Het
Map4 T A 9: 110,052,819 S250R possibly damaging Het
Mnt T A 11: 74,836,459 V57E possibly damaging Het
Mrc2 G A 11: 105,348,431 probably null Het
Mslnl G A 17: 25,742,934 V128M probably damaging Het
Musk A T 4: 58,301,625 I128F probably damaging Het
Myh4 G A 11: 67,250,310 A733T possibly damaging Het
Myo5a T A 9: 75,136,388 F220I probably damaging Het
Npas3 A G 12: 54,044,578 H305R probably damaging Het
Nrcam A T 12: 44,591,056 Y1132F probably damaging Het
Nt5c3b A C 11: 100,432,918 D189E probably benign Het
Nuf2 A G 1: 169,506,114 L331P probably damaging Het
Nup214 C T 2: 31,997,965 T646I probably benign Het
Olfr112 T C 17: 37,564,185 N42S probably damaging Het
Pcdh18 T C 3: 49,744,725 E1096G probably damaging Het
Pgm1 T A 5: 64,107,727 F364I probably benign Het
Pikfyve A G 1: 65,234,262 N612S probably damaging Het
Pla2g4e T G 2: 120,186,382 H226P possibly damaging Het
Ppp3cb T C 14: 20,520,646 N339S possibly damaging Het
Prkd2 G T 7: 16,843,648 probably benign Het
Rnf133 T C 6: 23,649,042 E296G possibly damaging Het
Sav1 A T 12: 69,984,321 D142E probably benign Het
Scn3b C A 9: 40,288,423 P212T probably damaging Het
Sel1l A T 12: 91,833,053 probably null Het
Sept9 A G 11: 117,360,484 K543E probably damaging Het
Serpinb12 T A 1: 106,949,153 D66E probably benign Het
Slc35e2 T C 4: 155,617,649 F290S probably benign Het
Snrpa A G 7: 27,195,533 M1T probably null Het
Soga1 T C 2: 157,039,924 K736R probably benign Het
Sptlc3 G A 2: 139,636,680 V520I probably benign Het
Srpk3 A G X: 73,774,941 H79R possibly damaging Het
Stox2 A G 8: 47,192,935 S497P probably damaging Het
Stradb G A 1: 58,993,572 S361N probably damaging Het
Sult3a2 T C 10: 33,782,087 K10R probably benign Het
Susd4 A G 1: 182,858,460 N192D probably damaging Het
Tcp10a T A 17: 7,325,975 D32E probably benign Het
Tdpoz4 T A 3: 93,797,032 V212D probably damaging Het
Tdrd5 T A 1: 156,284,374 T479S probably benign Het
Tex10 T C 4: 48,452,946 D671G probably benign Het
Traj37 T C 14: 54,181,539 probably benign Het
Ttc7b G A 12: 100,500,117 R79C probably damaging Het
Vmn2r115 T A 17: 23,346,399 L420Q probably benign Het
Wdr24 T A 17: 25,828,207 probably null Het
Wdr81 T A 11: 75,445,658 Q516L probably damaging Het
Zfp516 A G 18: 82,956,039 T121A probably benign Het
Zmat1 A T X: 134,972,945 S566T probably damaging Homo
Other mutations in Dnajc6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00162:Dnajc6 APN 4 101508089 intron probably benign
IGL02336:Dnajc6 APN 4 101614286 unclassified probably null
IGL02551:Dnajc6 APN 4 101639353 missense probably damaging 1.00
IGL02801:Dnajc6 APN 4 101597813 missense probably benign 0.33
IGL02887:Dnajc6 APN 4 101639300 missense probably damaging 1.00
IGL03107:Dnajc6 APN 4 101616860 missense probably damaging 1.00
IGL03271:Dnajc6 APN 4 101508077 intron probably benign
R0091:Dnajc6 UTSW 4 101616777 splice site probably benign
R0384:Dnajc6 UTSW 4 101598956 missense probably damaging 1.00
R0546:Dnajc6 UTSW 4 101635191 missense probably damaging 0.99
R0689:Dnajc6 UTSW 4 101611253 missense possibly damaging 0.91
R1239:Dnajc6 UTSW 4 101635116 missense probably damaging 0.98
R1421:Dnajc6 UTSW 4 101611316 missense probably damaging 0.97
R1424:Dnajc6 UTSW 4 101639347 missense possibly damaging 0.92
R1563:Dnajc6 UTSW 4 101599137 missense probably damaging 1.00
R1608:Dnajc6 UTSW 4 101599167 missense probably damaging 1.00
R1757:Dnajc6 UTSW 4 101597831 missense probably damaging 1.00
R1856:Dnajc6 UTSW 4 101598988 missense probably damaging 1.00
R2032:Dnajc6 UTSW 4 101614238 missense probably benign 0.39
R2518:Dnajc6 UTSW 4 101612930 missense probably damaging 0.99
R4028:Dnajc6 UTSW 4 101616857 missense probably damaging 1.00
R4088:Dnajc6 UTSW 4 101639396 missense probably damaging 1.00
R4602:Dnajc6 UTSW 4 101611264 missense probably damaging 1.00
R4610:Dnajc6 UTSW 4 101611264 missense probably damaging 1.00
R4755:Dnajc6 UTSW 4 101550799 missense probably damaging 1.00
R4878:Dnajc6 UTSW 4 101599034 intron probably benign
R4938:Dnajc6 UTSW 4 101636813 missense probably damaging 1.00
R5373:Dnajc6 UTSW 4 101615627 missense probably damaging 0.99
R5391:Dnajc6 UTSW 4 101628158 critical splice donor site probably null
R5435:Dnajc6 UTSW 4 101606610 missense probably damaging 0.99
R5760:Dnajc6 UTSW 4 101618642 missense probably benign 0.39
R6044:Dnajc6 UTSW 4 101616577 missense probably benign 0.22
R6086:Dnajc6 UTSW 4 101597807 missense probably benign 0.45
R6460:Dnajc6 UTSW 4 101615598 missense probably damaging 1.00
R6495:Dnajc6 UTSW 4 101635065 nonsense probably null
R6956:Dnajc6 UTSW 4 101614273 missense probably damaging 0.97
R7072:Dnajc6 UTSW 4 101615615 missense probably damaging 1.00
R7155:Dnajc6 UTSW 4 101612945 missense probably damaging 1.00
R7192:Dnajc6 UTSW 4 101597803 missense probably benign 0.02
R7226:Dnajc6 UTSW 4 101639372 missense probably damaging 1.00
R7298:Dnajc6 UTSW 4 101606611 missense probably benign 0.09
R7612:Dnajc6 UTSW 4 101597926 missense probably benign 0.40
R7622:Dnajc6 UTSW 4 101640491 missense probably damaging 1.00
R7652:Dnajc6 UTSW 4 101606677 missense probably damaging 0.98
Z1088:Dnajc6 UTSW 4 101639329 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCAAGTAGAATTTGTTTTCCTGAGC -3'
(R):5'- ATCATAGTTCAGGATAACAGCAACC -3'

Sequencing Primer
(F):5'- AAAAGTCTTTCCTTGATGCTTTGTG -3'
(R):5'- GTTCAGGATAACAGCAACCAATTAG -3'
Posted On2015-09-25