Incidental Mutation 'R4601:Abca16'
ID 345630
Institutional Source Beutler Lab
Gene Symbol Abca16
Ensembl Gene ENSMUSG00000051900
Gene Name ATP-binding cassette, sub-family A member 16
Synonyms
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R4601 (G1)
Quality Score 225
Status Not validated
Chromosome 7
Chromosomal Location 120008870-120144036 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to G at 120035920 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Phenylalanine to Leucine at position 334 (F334L)
Ref Sequence ENSEMBL: ENSMUSP00000061094 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000056042] [ENSMUST00000120490]
AlphaFold E9PWJ7
Predicted Effect probably damaging
Transcript: ENSMUST00000056042
AA Change: F334L

PolyPhen 2 Score 0.980 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000061094
Gene: ENSMUSG00000051900
AA Change: F334L

DomainStartEndE-ValueType
Pfam:ABC2_membrane_3 26 455 2.7e-23 PFAM
AAA 537 720 2.01e-7 SMART
Pfam:ABC2_membrane_3 898 1287 4.6e-25 PFAM
low complexity region 1325 1336 N/A INTRINSIC
low complexity region 1342 1353 N/A INTRINSIC
AAA 1378 1563 4.23e-6 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000120490
AA Change: F334L

PolyPhen 2 Score 0.946 (Sensitivity: 0.80; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000112736
Gene: ENSMUSG00000051900
AA Change: F334L

DomainStartEndE-ValueType
Pfam:ABC2_membrane_3 25 456 2.4e-22 PFAM
AAA 538 721 2.01e-7 SMART
Pfam:ABC2_membrane_3 899 1288 1.1e-27 PFAM
low complexity region 1326 1337 N/A INTRINSIC
low complexity region 1343 1354 N/A INTRINSIC
AAA 1379 1564 4.23e-6 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144122
SMART Domains Protein: ENSMUSP00000114975
Gene: ENSMUSG00000051900

DomainStartEndE-ValueType
Pfam:ABC2_membrane_3 2 133 1e-16 PFAM
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.1%
  • 20x: 94.5%
Validation Efficiency
Allele List at MGI

All alleles(4) : Targeted(3) Gene trapped(1

Other mutations in this stock
Total: 91 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aars2 T A 17: 45,827,847 (GRCm39) D555E probably damaging Het
Abcc4 T A 14: 118,869,575 (GRCm39) M186L probably benign Het
Agap3 T C 5: 24,681,406 (GRCm39) L120P probably damaging Het
Ak7 G A 12: 105,679,834 (GRCm39) V123M probably benign Het
Aldh1a7 A T 19: 20,693,343 (GRCm39) V192D probably damaging Het
Ankrd36 A G 11: 5,520,102 (GRCm39) D59G probably benign Het
Arsi G A 18: 61,049,723 (GRCm39) G202E probably benign Het
Cacna1e A G 1: 154,347,359 (GRCm39) V936A probably benign Het
Camkv T C 9: 107,823,295 (GRCm39) V107A probably damaging Het
Camp T C 9: 109,677,730 (GRCm39) E80G probably damaging Het
Cblif A C 19: 11,729,554 (GRCm39) D171A probably damaging Het
Ccdc66 T C 14: 27,222,377 (GRCm39) N122S probably damaging Het
Cd101 G A 3: 100,901,204 (GRCm39) T960M possibly damaging Het
Cdk18 A G 1: 132,044,657 (GRCm39) V323A possibly damaging Het
Celf2 G T 2: 6,590,831 (GRCm39) N279K possibly damaging Het
Cemip T C 7: 83,600,826 (GRCm39) I932V probably damaging Het
Cep250 C A 2: 155,803,973 (GRCm39) Q28K probably benign Het
Ces2f T C 8: 105,676,596 (GRCm39) C97R probably damaging Het
Cfap126 G T 1: 170,941,627 (GRCm39) G41C possibly damaging Het
Cfap96 A T 8: 46,423,505 (GRCm39) I69N probably damaging Het
Chat T C 14: 32,146,112 (GRCm39) M354V probably benign Het
Clca4b A T 3: 144,632,945 (GRCm39) D168E possibly damaging Het
Cpxm1 T A 2: 130,235,496 (GRCm39) M499L possibly damaging Het
Dennd3 T A 15: 73,439,009 (GRCm39) W1126R probably damaging Het
Dgkb T C 12: 38,652,819 (GRCm39) S735P probably damaging Het
Dlec1 T C 9: 118,976,202 (GRCm39) probably null Het
Dnajc6 T C 4: 101,468,461 (GRCm39) F166L probably damaging Het
Dph5 A G 3: 115,693,426 (GRCm39) N115D possibly damaging Het
Ercc3 G A 18: 32,378,624 (GRCm39) A202T probably benign Het
Erich3 A T 3: 154,470,375 (GRCm39) D136V unknown Het
Exoc2 T C 13: 31,066,251 (GRCm39) N475S probably benign Het
Fam217a T C 13: 35,095,285 (GRCm39) D310G probably damaging Het
Fam53a C T 5: 33,758,007 (GRCm39) S372N probably benign Het
Fbn2 C G 18: 58,186,805 (GRCm39) G1699R probably damaging Het
Fbxo46 T C 7: 18,869,489 (GRCm39) V36A probably benign Het
Fhip1a T C 3: 85,648,487 (GRCm39) M26V probably damaging Het
G6pc1 A G 11: 101,263,567 (GRCm39) Y127C probably damaging Het
Gba2 A G 4: 43,573,810 (GRCm39) F161L probably damaging Het
Gja1 T C 10: 56,264,325 (GRCm39) L228P probably damaging Het
Gm20834 A G Y: 10,323,178 (GRCm39) V86A probably benign Het
Hmcn1 A T 1: 150,614,396 (GRCm39) C1337S probably damaging Het
Il1rl1 T A 1: 40,480,460 (GRCm39) S30T possibly damaging Het
Itgb4 A G 11: 115,896,548 (GRCm39) T1436A probably damaging Het
Itk T A 11: 46,227,342 (GRCm39) Q427L probably benign Het
Klhdc4 T C 8: 122,526,266 (GRCm39) E291G probably damaging Het
Map4 T A 9: 109,881,887 (GRCm39) S250R possibly damaging Het
Mnt T A 11: 74,727,285 (GRCm39) V57E possibly damaging Het
Mrc2 G A 11: 105,239,257 (GRCm39) probably null Het
Mslnl G A 17: 25,961,908 (GRCm39) V128M probably damaging Het
Mtcl2 T C 2: 156,881,844 (GRCm39) K736R probably benign Het
Musk A T 4: 58,301,625 (GRCm39) I128F probably damaging Het
Myh4 G A 11: 67,141,136 (GRCm39) A733T possibly damaging Het
Myo5a T A 9: 75,043,670 (GRCm39) F220I probably damaging Het
Npas3 A G 12: 54,091,361 (GRCm39) H305R probably damaging Het
Nrcam A T 12: 44,637,839 (GRCm39) Y1132F probably damaging Het
Nt5c3b A C 11: 100,323,744 (GRCm39) D189E probably benign Het
Nuf2 A G 1: 169,333,683 (GRCm39) L331P probably damaging Het
Nup214 C T 2: 31,887,977 (GRCm39) T646I probably benign Het
Or14j9 T C 17: 37,875,076 (GRCm39) N42S probably damaging Het
Pcdh18 T C 3: 49,699,174 (GRCm39) E1096G probably damaging Het
Pgm2 T A 5: 64,265,070 (GRCm39) F364I probably benign Het
Pikfyve A G 1: 65,273,421 (GRCm39) N612S probably damaging Het
Pla2g4e T G 2: 120,016,863 (GRCm39) H226P possibly damaging Het
Ppp3cb T C 14: 20,570,714 (GRCm39) N339S possibly damaging Het
Prkd2 G T 7: 16,577,573 (GRCm39) probably benign Het
Rnf133 T C 6: 23,649,041 (GRCm39) E296G possibly damaging Het
Sav1 A T 12: 70,031,095 (GRCm39) D142E probably benign Het
Scn3b C A 9: 40,199,719 (GRCm39) P212T probably damaging Het
Sel1l A T 12: 91,799,827 (GRCm39) probably null Het
Septin9 A G 11: 117,251,310 (GRCm39) K543E probably damaging Het
Serpinb12 T A 1: 106,876,883 (GRCm39) D66E probably benign Het
Slc35e2 T C 4: 155,702,106 (GRCm39) F290S probably benign Het
Snrpa A G 7: 26,894,958 (GRCm39) M1T probably null Het
Sptlc3 G A 2: 139,478,600 (GRCm39) V520I probably benign Het
Srpk3 A G X: 72,818,547 (GRCm39) H79R possibly damaging Het
Stox2 A G 8: 47,645,970 (GRCm39) S497P probably damaging Het
Stradb G A 1: 59,032,731 (GRCm39) S361N probably damaging Het
Sult3a2 T C 10: 33,658,083 (GRCm39) K10R probably benign Het
Susd4 A G 1: 182,686,025 (GRCm39) N192D probably damaging Het
Tcp10a T A 17: 7,593,374 (GRCm39) D32E probably benign Het
Tdpoz4 T A 3: 93,704,339 (GRCm39) V212D probably damaging Het
Tdrd5 T A 1: 156,111,944 (GRCm39) T479S probably benign Het
Tex10 T C 4: 48,452,946 (GRCm39) D671G probably benign Het
Tex55 A G 16: 38,648,380 (GRCm39) V243A probably benign Het
Traj37 T C 14: 54,418,996 (GRCm39) probably benign Het
Ttc7b G A 12: 100,466,376 (GRCm39) R79C probably damaging Het
Vmn2r115 T A 17: 23,565,373 (GRCm39) L420Q probably benign Het
Wdr24 T A 17: 26,047,181 (GRCm39) probably null Het
Wdr81 T A 11: 75,336,484 (GRCm39) Q516L probably damaging Het
Zfp516 A G 18: 82,974,164 (GRCm39) T121A probably benign Het
Zmat1 A T X: 133,873,694 (GRCm39) S566T probably damaging Homo
Other mutations in Abca16
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00417:Abca16 APN 7 120,022,982 (GRCm39) missense probably benign 0.08
IGL00590:Abca16 APN 7 120,023,038 (GRCm39) missense probably damaging 1.00
IGL01320:Abca16 APN 7 120,038,422 (GRCm39) missense probably damaging 1.00
IGL01322:Abca16 APN 7 120,038,422 (GRCm39) missense probably damaging 1.00
IGL01613:Abca16 APN 7 120,140,500 (GRCm39) missense probably benign 0.03
IGL01774:Abca16 APN 7 120,021,024 (GRCm39) splice site probably benign
IGL01774:Abca16 APN 7 120,077,058 (GRCm39) missense probably damaging 1.00
IGL01797:Abca16 APN 7 120,113,760 (GRCm39) missense probably benign 0.15
IGL02406:Abca16 APN 7 120,139,825 (GRCm39) missense probably damaging 1.00
IGL02437:Abca16 APN 7 120,132,952 (GRCm39) missense probably benign 0.00
IGL02541:Abca16 APN 7 120,113,881 (GRCm39) missense possibly damaging 0.91
IGL02576:Abca16 APN 7 120,032,678 (GRCm39) missense probably benign 0.05
IGL02578:Abca16 APN 7 120,023,179 (GRCm39) critical splice donor site probably null
IGL03156:Abca16 APN 7 120,023,074 (GRCm39) missense possibly damaging 0.69
IGL03381:Abca16 APN 7 120,127,041 (GRCm39) missense probably benign 0.12
PIT4802001:Abca16 UTSW 7 120,139,351 (GRCm39) missense probably benign 0.31
R0024:Abca16 UTSW 7 120,032,608 (GRCm39) missense probably damaging 1.00
R0026:Abca16 UTSW 7 120,077,146 (GRCm39) splice site probably benign
R0026:Abca16 UTSW 7 120,077,146 (GRCm39) splice site probably benign
R0123:Abca16 UTSW 7 120,139,378 (GRCm39) missense probably damaging 1.00
R0134:Abca16 UTSW 7 120,139,378 (GRCm39) missense probably damaging 1.00
R0225:Abca16 UTSW 7 120,139,378 (GRCm39) missense probably damaging 1.00
R0346:Abca16 UTSW 7 120,035,155 (GRCm39) missense probably damaging 1.00
R0355:Abca16 UTSW 7 120,023,021 (GRCm39) missense possibly damaging 0.68
R0358:Abca16 UTSW 7 120,143,939 (GRCm39) missense probably benign 0.01
R0525:Abca16 UTSW 7 120,065,033 (GRCm39) nonsense probably null
R0617:Abca16 UTSW 7 120,032,834 (GRCm39) splice site probably benign
R0625:Abca16 UTSW 7 120,035,116 (GRCm39) missense probably damaging 1.00
R0835:Abca16 UTSW 7 120,065,007 (GRCm39) missense probably benign 0.42
R1445:Abca16 UTSW 7 120,119,256 (GRCm39) missense probably benign 0.41
R1535:Abca16 UTSW 7 120,139,928 (GRCm39) missense probably benign 0.30
R1567:Abca16 UTSW 7 120,030,352 (GRCm39) missense probably benign 0.08
R1694:Abca16 UTSW 7 120,119,307 (GRCm39) missense probably damaging 1.00
R1860:Abca16 UTSW 7 120,133,986 (GRCm39) missense probably benign 0.02
R1876:Abca16 UTSW 7 120,032,608 (GRCm39) missense probably damaging 1.00
R1913:Abca16 UTSW 7 120,140,463 (GRCm39) missense probably benign 0.04
R1940:Abca16 UTSW 7 120,032,832 (GRCm39) splice site probably benign
R2042:Abca16 UTSW 7 120,143,941 (GRCm39) missense probably benign
R2115:Abca16 UTSW 7 120,139,868 (GRCm39) missense probably damaging 1.00
R2122:Abca16 UTSW 7 120,119,184 (GRCm39) missense probably damaging 1.00
R2265:Abca16 UTSW 7 120,030,383 (GRCm39) missense probably benign 0.03
R2267:Abca16 UTSW 7 120,030,383 (GRCm39) missense probably benign 0.03
R2269:Abca16 UTSW 7 120,030,383 (GRCm39) missense probably benign 0.03
R2993:Abca16 UTSW 7 120,134,384 (GRCm39) missense probably damaging 1.00
R3055:Abca16 UTSW 7 120,035,074 (GRCm39) missense probably benign 0.05
R3956:Abca16 UTSW 7 120,126,975 (GRCm39) missense probably damaging 0.96
R4114:Abca16 UTSW 7 120,126,290 (GRCm39) missense probably benign 0.06
R4441:Abca16 UTSW 7 120,127,024 (GRCm39) missense probably benign 0.04
R4706:Abca16 UTSW 7 120,064,988 (GRCm39) missense probably damaging 1.00
R4807:Abca16 UTSW 7 120,139,832 (GRCm39) missense probably damaging 1.00
R4824:Abca16 UTSW 7 120,074,702 (GRCm39) missense possibly damaging 0.86
R4937:Abca16 UTSW 7 120,126,309 (GRCm39) missense probably damaging 0.98
R5152:Abca16 UTSW 7 120,139,846 (GRCm39) missense probably benign 0.02
R5257:Abca16 UTSW 7 120,035,992 (GRCm39) critical splice donor site probably null
R5258:Abca16 UTSW 7 120,035,992 (GRCm39) critical splice donor site probably null
R5330:Abca16 UTSW 7 120,102,600 (GRCm39) missense probably benign 0.15
R5388:Abca16 UTSW 7 120,139,969 (GRCm39) critical splice donor site probably null
R5590:Abca16 UTSW 7 120,143,995 (GRCm39) missense probably damaging 0.98
R5810:Abca16 UTSW 7 120,035,155 (GRCm39) missense probably damaging 1.00
R6030:Abca16 UTSW 7 120,133,021 (GRCm39) missense probably benign
R6030:Abca16 UTSW 7 120,133,021 (GRCm39) missense probably benign
R6161:Abca16 UTSW 7 120,139,934 (GRCm39) missense probably damaging 1.00
R6313:Abca16 UTSW 7 120,126,344 (GRCm39) missense probably damaging 1.00
R6485:Abca16 UTSW 7 120,026,390 (GRCm39) nonsense probably null
R6527:Abca16 UTSW 7 120,076,995 (GRCm39) missense possibly damaging 0.95
R6772:Abca16 UTSW 7 120,126,276 (GRCm39) missense probably damaging 1.00
R6885:Abca16 UTSW 7 120,119,332 (GRCm39) missense probably benign 0.07
R6899:Abca16 UTSW 7 120,126,264 (GRCm39) missense probably damaging 1.00
R6941:Abca16 UTSW 7 120,140,370 (GRCm39) missense probably damaging 1.00
R6990:Abca16 UTSW 7 120,126,950 (GRCm39) missense probably benign 0.00
R7059:Abca16 UTSW 7 120,020,971 (GRCm39) missense probably benign 0.00
R7144:Abca16 UTSW 7 120,032,796 (GRCm39) missense possibly damaging 0.89
R7146:Abca16 UTSW 7 120,126,974 (GRCm39) missense possibly damaging 0.46
R7193:Abca16 UTSW 7 120,026,409 (GRCm39) missense probably damaging 1.00
R7308:Abca16 UTSW 7 120,022,993 (GRCm39) missense probably benign 0.01
R7449:Abca16 UTSW 7 120,035,131 (GRCm39) missense possibly damaging 0.95
R7571:Abca16 UTSW 7 120,119,211 (GRCm39) missense probably benign 0.11
R7617:Abca16 UTSW 7 120,102,694 (GRCm39) nonsense probably null
R7646:Abca16 UTSW 7 120,113,937 (GRCm39) missense probably benign 0.04
R7750:Abca16 UTSW 7 120,113,928 (GRCm39) missense probably benign 0.09
R7763:Abca16 UTSW 7 120,113,825 (GRCm39) missense probably damaging 1.00
R7840:Abca16 UTSW 7 120,074,689 (GRCm39) missense probably benign 0.00
R7946:Abca16 UTSW 7 120,126,398 (GRCm39) missense probably benign 0.01
R8018:Abca16 UTSW 7 120,132,866 (GRCm39) missense probably benign 0.04
R8170:Abca16 UTSW 7 120,065,005 (GRCm39) missense probably damaging 1.00
R8413:Abca16 UTSW 7 120,023,123 (GRCm39) missense probably benign 0.06
R8461:Abca16 UTSW 7 120,035,918 (GRCm39) missense possibly damaging 0.95
R8858:Abca16 UTSW 7 120,052,327 (GRCm39) missense probably benign
R8881:Abca16 UTSW 7 120,074,794 (GRCm39) missense probably benign 0.18
R9272:Abca16 UTSW 7 120,076,993 (GRCm39) missense probably benign 0.13
R9303:Abca16 UTSW 7 120,126,989 (GRCm39) missense probably benign 0.25
R9305:Abca16 UTSW 7 120,126,989 (GRCm39) missense probably benign 0.25
R9320:Abca16 UTSW 7 120,139,320 (GRCm39) missense probably damaging 0.98
R9413:Abca16 UTSW 7 120,126,422 (GRCm39) missense probably benign 0.01
R9512:Abca16 UTSW 7 120,022,963 (GRCm39) missense probably benign 0.01
R9559:Abca16 UTSW 7 120,021,019 (GRCm39) critical splice donor site probably null
R9615:Abca16 UTSW 7 120,126,404 (GRCm39) missense probably benign 0.01
R9641:Abca16 UTSW 7 120,126,308 (GRCm39) missense possibly damaging 0.52
R9643:Abca16 UTSW 7 120,065,023 (GRCm39) missense possibly damaging 0.96
R9674:Abca16 UTSW 7 120,074,668 (GRCm39) critical splice acceptor site probably null
R9714:Abca16 UTSW 7 120,030,383 (GRCm39) missense probably benign 0.01
R9799:Abca16 UTSW 7 120,132,998 (GRCm39) missense probably benign 0.00
R9800:Abca16 UTSW 7 120,119,283 (GRCm39) missense possibly damaging 0.68
RF020:Abca16 UTSW 7 120,132,880 (GRCm39) missense possibly damaging 0.90
X0066:Abca16 UTSW 7 120,102,609 (GRCm39) missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AAGACTTTAACTTCCTGTCTTTGGG -3'
(R):5'- AGAATTTACTGGTCTAGAAACGAGC -3'

Sequencing Primer
(F):5'- GTCTCACCAGCTGAGTGTG -3'
(R):5'- TTACTGGTCTAGAAACGAGCAAAAAG -3'
Posted On 2015-09-25