Incidental Mutation 'R4602:Jak1'
ID345704
Institutional Source Beutler Lab
Gene Symbol Jak1
Ensembl Gene ENSMUSG00000028530
Gene NameJanus kinase 1
Synonyms
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4602 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location101152367-101265282 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 101179594 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Aspartic acid at position 283 (A283D)
Ref Sequence ENSEMBL: ENSMUSP00000099842 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000102781]
Predicted Effect possibly damaging
Transcript: ENSMUST00000102781
AA Change: A283D

PolyPhen 2 Score 0.834 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000099842
Gene: ENSMUSG00000028530
AA Change: A283D

DomainStartEndE-ValueType
B41 32 286 2.45e-58 SMART
Blast:B41 291 420 4e-51 BLAST
SH2 437 531 1.85e-13 SMART
STYKc 582 844 6.72e-14 SMART
TyrKc 874 1148 9.01e-122 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132292
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136167
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147211
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155328
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a membrane protein that is a member of a class of protein-tyrosine kinases (PTK) characterized by the presence of a second phosphotransferase-related domain immediately N-terminal to the PTK domain. The encoded kinase phosphorylates STAT proteins (signal transducers and activators of transcription) and plays a key role in interferon-alpha/beta and interferon-gamma signal transduction. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2016]
PHENOTYPE: Mice homozygous for disruption of this gene die within the first 24 hours after birth. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700029J07Rik A T 8: 45,970,468 I69N probably damaging Het
Ahnak A G 19: 9,010,825 K3158E possibly damaging Het
Ak7 G A 12: 105,713,575 V123M probably benign Het
Ankmy1 A T 1: 92,888,650 N247K probably benign Het
Atp1a1 A G 3: 101,586,943 V447A probably benign Het
Atp1a4 A C 1: 172,239,765 M600R probably damaging Het
Baat A G 4: 49,502,727 Y132H probably damaging Het
Ceacam15 A G 7: 16,671,981 V215A probably damaging Het
Celf2 G T 2: 6,586,020 N279K possibly damaging Het
Clec14a C T 12: 58,267,981 R285H probably benign Het
Ctnna1 T G 18: 35,179,827 I244R possibly damaging Het
D230025D16Rik C A 8: 105,246,888 N282K possibly damaging Het
Dcxr T A 11: 120,726,304 N105Y possibly damaging Het
Dnajc6 T C 4: 101,611,264 F166L probably damaging Het
Ercc3 G A 18: 32,245,571 A202T probably benign Het
Faf1 A G 4: 109,727,428 D67G probably benign Het
Fancm G A 12: 65,124,944 R1786H probably benign Het
Fnbp1 A G 2: 31,036,540 probably null Het
Frem2 A G 3: 53,547,807 L2116S possibly damaging Het
Gbp5 A G 3: 142,503,785 E164G probably benign Het
Gm4922 A T 10: 18,784,259 Y238* probably null Het
Gm8257 A G 14: 44,656,317 Y62H probably damaging Het
Grin2b A G 6: 135,778,741 F525S probably damaging Het
Hfe2 T G 3: 96,527,553 S203A probably benign Het
Hsd17b3 C A 13: 64,063,170 probably null Het
Ighv1-23 T A 12: 114,764,559 Q81L probably benign Het
Inpp4b T C 8: 81,969,535 V366A probably damaging Het
Kmt2d G T 15: 98,850,259 probably benign Het
Mbtps1 A T 8: 119,535,347 D354E probably damaging Het
Mettl17 T C 14: 51,888,789 V218A probably damaging Het
Mrc2 G A 11: 105,348,431 probably null Het
Nfat5 C T 8: 107,367,223 Q699* probably null Het
Olfr1193 G A 2: 88,677,896 V14I probably benign Het
Olfr1193 T G 2: 88,678,179 V101G probably benign Het
Olfr868 C A 9: 20,101,244 H162N probably benign Het
Osbpl7 C A 11: 97,056,269 S265R possibly damaging Het
Pcdh15 A G 10: 74,594,214 T1258A probably damaging Het
Pcdh20 A T 14: 88,468,430 L478Q probably damaging Het
Pde11a A G 2: 76,158,333 V488A probably benign Het
Phactr1 A T 13: 43,094,965 E463D probably benign Het
Samd9l A T 6: 3,373,935 Y1109N probably damaging Het
Samd9l GAA GAAA 6: 3,373,937 probably null Het
Secisbp2l C T 2: 125,740,737 G933D possibly damaging Het
Serpinb12 T A 1: 106,949,153 D66E probably benign Het
Sgk2 G A 2: 162,994,754 probably null Het
Slco1a6 C A 6: 142,101,652 C404F probably benign Het
Spaca6 C T 17: 17,831,125 A21V probably damaging Het
Sphkap G T 1: 83,279,061 Y322* probably null Het
Sptlc3 G A 2: 139,636,680 V520I probably benign Het
Stox2 A G 8: 47,192,935 S497P probably damaging Het
Syt9 A T 7: 107,436,387 K204* probably null Het
Taf3 A G 2: 9,952,657 V233A probably damaging Het
Tbccd1 T C 16: 22,818,535 probably null Het
Tdrd5 T A 1: 156,284,374 T479S probably benign Het
Tex10 T C 4: 48,452,946 D671G probably benign Het
Tgtp2 T C 11: 49,058,984 T254A probably damaging Het
Tmtc2 T C 10: 105,413,530 Y114C probably benign Het
Tns2 C T 15: 102,108,934 R281C probably damaging Het
Ubac1 A T 2: 25,998,977 I402N probably damaging Het
Zmat1 A T X: 134,972,945 S566T probably damaging Homo
Other mutations in Jak1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00906:Jak1 APN 4 101154629 missense probably damaging 1.00
IGL00990:Jak1 APN 4 101171357 missense probably damaging 1.00
IGL01341:Jak1 APN 4 101175093 missense probably damaging 0.98
IGL02102:Jak1 APN 4 101159086 missense probably benign 0.11
IGL02720:Jak1 APN 4 101164450 splice site probably benign
IGL03301:Jak1 APN 4 101175173 missense probably damaging 1.00
Back UTSW 4 101174211 critical splice acceptor site probably null
Behind UTSW 4 101154537 critical splice donor site probably null
BB006:Jak1 UTSW 4 101154645 missense probably damaging 1.00
BB016:Jak1 UTSW 4 101154645 missense probably damaging 1.00
PIT4377001:Jak1 UTSW 4 101179551 missense probably benign 0.19
R0308:Jak1 UTSW 4 101154535 splice site probably null
R0544:Jak1 UTSW 4 101191625 missense probably benign
R1212:Jak1 UTSW 4 101189094 missense probably damaging 1.00
R1519:Jak1 UTSW 4 101162922 missense probably damaging 0.99
R1627:Jak1 UTSW 4 101191624 splice site probably null
R1760:Jak1 UTSW 4 101162929 missense probably benign 0.04
R2116:Jak1 UTSW 4 101179675 missense probably damaging 0.98
R2980:Jak1 UTSW 4 101179781 missense probably damaging 0.99
R3738:Jak1 UTSW 4 101191468 unclassified probably benign
R3779:Jak1 UTSW 4 101156490 missense probably benign 0.40
R4172:Jak1 UTSW 4 101159132 missense probably benign 0.08
R4505:Jak1 UTSW 4 101154603 missense probably benign
R4755:Jak1 UTSW 4 101174157 missense probably damaging 1.00
R4836:Jak1 UTSW 4 101155066 missense probably damaging 0.97
R4908:Jak1 UTSW 4 101179714 missense probably damaging 1.00
R5116:Jak1 UTSW 4 101155113 missense probably benign
R6190:Jak1 UTSW 4 101175128 missense probably damaging 1.00
R6339:Jak1 UTSW 4 101161926 missense probably damaging 0.99
R6500:Jak1 UTSW 4 101181933 missense probably benign 0.43
R6551:Jak1 UTSW 4 101193843 start gained probably benign
R6895:Jak1 UTSW 4 101154537 critical splice donor site probably null
R7163:Jak1 UTSW 4 101175188 missense probably damaging 1.00
R7204:Jak1 UTSW 4 101175135 missense probably benign 0.02
R7361:Jak1 UTSW 4 101184339 missense possibly damaging 0.86
R7408:Jak1 UTSW 4 101175182 missense probably damaging 0.96
R7513:Jak1 UTSW 4 101191651 missense probably damaging 0.96
R7617:Jak1 UTSW 4 101174211 critical splice acceptor site probably null
R7779:Jak1 UTSW 4 101160142 missense probably benign
R7929:Jak1 UTSW 4 101154645 missense probably damaging 1.00
R8282:Jak1 UTSW 4 101179541 nonsense probably null
Z1176:Jak1 UTSW 4 101163681 missense probably damaging 1.00
Z1176:Jak1 UTSW 4 101163722 missense probably benign 0.09
Predicted Primers PCR Primer
(F):5'- GCACATTCCCTTGATGACCC -3'
(R):5'- GCTACAAGCGATATATTCCAGAAAC -3'

Sequencing Primer
(F):5'- CCCTTGATGACCCTGGATATTC -3'
(R):5'- CATTGAATAAATCCATCAGACAGAGG -3'
Posted On2015-09-25