Incidental Mutation 'R4602:Fancm'
ID345735
Institutional Source Beutler Lab
Gene Symbol Fancm
Ensembl Gene ENSMUSG00000055884
Gene NameFanconi anemia, complementation group M
SynonymsD12Ertd364e, C730036B14Rik
Accession Numbers

Ncbi RefSeq: NM_178912.3; MGI:2442306

Is this an essential gene? Probably essential (E-score: 0.876) question?
Stock #R4602 (G1)
Quality Score225
Status Not validated
Chromosome12
Chromosomal Location65075603-65132058 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 65124944 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Histidine at position 1786 (R1786H)
Ref Sequence ENSEMBL: ENSMUSP00000054797 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000058889] [ENSMUST00000222540]
Predicted Effect probably benign
Transcript: ENSMUST00000058889
AA Change: R1786H

PolyPhen 2 Score 0.117 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000054797
Gene: ENSMUSG00000055884
AA Change: R1786H

DomainStartEndE-ValueType
DEXDc 75 275 5.6e-25 SMART
Blast:DEXDc 295 323 9e-6 BLAST
low complexity region 339 348 N/A INTRINSIC
HELICc 475 566 5.64e-21 SMART
Pfam:FANCM-MHF_bd 657 770 8.5e-50 PFAM
low complexity region 850 866 N/A INTRINSIC
low complexity region 974 987 N/A INTRINSIC
low complexity region 1105 1120 N/A INTRINSIC
low complexity region 1165 1178 N/A INTRINSIC
PDB:4DAY|C 1207 1238 1e-6 PDB
low complexity region 1489 1506 N/A INTRINSIC
low complexity region 1572 1586 N/A INTRINSIC
low complexity region 1669 1682 N/A INTRINSIC
ERCC4 1780 1863 2.07e-12 SMART
Predicted Effect unknown
Transcript: ENSMUST00000221175
AA Change: R29H
Predicted Effect noncoding transcript
Transcript: ENSMUST00000222086
Predicted Effect probably benign
Transcript: ENSMUST00000222540
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.7%
Validation Efficiency
MGI Phenotype Strain: 4355560
Lethality: D500-D600
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The Fanconi anemia complementation group (FANC) currently includes FANCA, FANCB, FANCC, FANCD1 (also called BRCA2), FANCD2, FANCE, FANCF, FANCG, FANCI, FANCJ (also called BRIP1), FANCL, FANCM and FANCN (also called PALB2). The previously defined group FANCH is the same as FANCA. Fanconi anemia is a genetically heterogeneous recessive disorder characterized by cytogenetic instability, hypersensitivity to DNA crosslinking agents, increased chromosomal breakage, and defective DNA repair. The members of the Fanconi anemia complementation group do not share sequence similarity; they are related by their assembly into a common nuclear protein complex. This gene encodes the protein for complementation group M. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Apr 2015]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit reduced female transmission, hypogonadism, premature death, and increased incidence of tumors. [provided by MGI curators]
Allele List at MGI

All alleles(39) : Targeted(4) Gene trapped(35)

Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700029J07Rik A T 8: 45,970,468 I69N probably damaging Het
Ahnak A G 19: 9,010,825 K3158E possibly damaging Het
Ak7 G A 12: 105,713,575 V123M probably benign Het
Ankmy1 A T 1: 92,888,650 N247K probably benign Het
Atp1a1 A G 3: 101,586,943 V447A probably benign Het
Atp1a4 A C 1: 172,239,765 M600R probably damaging Het
Baat A G 4: 49,502,727 Y132H probably damaging Het
Ceacam15 A G 7: 16,671,981 V215A probably damaging Het
Celf2 G T 2: 6,586,020 N279K possibly damaging Het
Clec14a C T 12: 58,267,981 R285H probably benign Het
Ctnna1 T G 18: 35,179,827 I244R possibly damaging Het
D230025D16Rik C A 8: 105,246,888 N282K possibly damaging Het
Dcxr T A 11: 120,726,304 N105Y possibly damaging Het
Dnajc6 T C 4: 101,611,264 F166L probably damaging Het
Ercc3 G A 18: 32,245,571 A202T probably benign Het
Faf1 A G 4: 109,727,428 D67G probably benign Het
Fnbp1 A G 2: 31,036,540 probably null Het
Frem2 A G 3: 53,547,807 L2116S possibly damaging Het
Gbp5 A G 3: 142,503,785 E164G probably benign Het
Gm4922 A T 10: 18,784,259 Y238* probably null Het
Gm8257 A G 14: 44,656,317 Y62H probably damaging Het
Grin2b A G 6: 135,778,741 F525S probably damaging Het
Hfe2 T G 3: 96,527,553 S203A probably benign Het
Hsd17b3 C A 13: 64,063,170 probably null Het
Ighv1-23 T A 12: 114,764,559 Q81L probably benign Het
Inpp4b T C 8: 81,969,535 V366A probably damaging Het
Jak1 G T 4: 101,179,594 A283D possibly damaging Het
Kmt2d G T 15: 98,850,259 probably benign Het
Mbtps1 A T 8: 119,535,347 D354E probably damaging Het
Mettl17 T C 14: 51,888,789 V218A probably damaging Het
Mrc2 G A 11: 105,348,431 probably null Het
Nfat5 C T 8: 107,367,223 Q699* probably null Het
Olfr1193 G A 2: 88,677,896 V14I probably benign Het
Olfr1193 T G 2: 88,678,179 V101G probably benign Het
Olfr868 C A 9: 20,101,244 H162N probably benign Het
Osbpl7 C A 11: 97,056,269 S265R possibly damaging Het
Pcdh15 A G 10: 74,594,214 T1258A probably damaging Het
Pcdh20 A T 14: 88,468,430 L478Q probably damaging Het
Pde11a A G 2: 76,158,333 V488A probably benign Het
Phactr1 A T 13: 43,094,965 E463D probably benign Het
Samd9l A T 6: 3,373,935 Y1109N probably damaging Het
Samd9l GAA GAAA 6: 3,373,937 probably null Het
Secisbp2l C T 2: 125,740,737 G933D possibly damaging Het
Serpinb12 T A 1: 106,949,153 D66E probably benign Het
Sgk2 G A 2: 162,994,754 probably null Het
Slco1a6 C A 6: 142,101,652 C404F probably benign Het
Spaca6 C T 17: 17,831,125 A21V probably damaging Het
Sphkap G T 1: 83,279,061 Y322* probably null Het
Sptlc3 G A 2: 139,636,680 V520I probably benign Het
Stox2 A G 8: 47,192,935 S497P probably damaging Het
Syt9 A T 7: 107,436,387 K204* probably null Het
Taf3 A G 2: 9,952,657 V233A probably damaging Het
Tbccd1 T C 16: 22,818,535 probably null Het
Tdrd5 T A 1: 156,284,374 T479S probably benign Het
Tex10 T C 4: 48,452,946 D671G probably benign Het
Tgtp2 T C 11: 49,058,984 T254A probably damaging Het
Tmtc2 T C 10: 105,413,530 Y114C probably benign Het
Tns2 C T 15: 102,108,934 R281C probably damaging Het
Ubac1 A T 2: 25,998,977 I402N probably damaging Het
Zmat1 A T X: 134,972,945 S566T probably damaging Homo
Other mutations in Fancm
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00158:Fancm APN 12 65075736 missense possibly damaging 0.50
IGL00489:Fancm APN 12 65106193 missense probably benign 0.01
IGL00529:Fancm APN 12 65130417 utr 3 prime probably benign
IGL00898:Fancm APN 12 65106000 missense probably benign 0.01
IGL01805:Fancm APN 12 65113861 critical splice donor site probably null
IGL01986:Fancm APN 12 65126655 nonsense probably null
IGL02026:Fancm APN 12 65105734 missense probably benign 0.03
IGL02069:Fancm APN 12 65075911 missense probably benign 0.05
IGL02103:Fancm APN 12 65095784 missense probably benign 0.38
IGL02133:Fancm APN 12 65106475 missense probably benign 0.04
IGL02400:Fancm APN 12 65113815 missense probably damaging 1.00
IGL02478:Fancm APN 12 65077090 missense probably damaging 1.00
IGL02479:Fancm APN 12 65106485 missense probably damaging 0.98
IGL02563:Fancm APN 12 65092462 missense probably damaging 1.00
IGL02606:Fancm APN 12 65076139 missense possibly damaging 0.90
IGL02731:Fancm APN 12 65088305 missense probably benign 0.00
IGL02809:Fancm APN 12 65121667 missense possibly damaging 0.54
IGL02953:Fancm APN 12 65121966 missense probably benign 0.27
IGL03066:Fancm APN 12 65125114 nonsense probably null
IGL03073:Fancm APN 12 65101632 missense probably damaging 1.00
PIT4131001:Fancm UTSW 12 65105422 missense probably benign 0.03
R0041:Fancm UTSW 12 65106443 nonsense probably null
R0041:Fancm UTSW 12 65106443 nonsense probably null
R0125:Fancm UTSW 12 65121956 missense possibly damaging 0.68
R0201:Fancm UTSW 12 65101632 missense probably damaging 1.00
R0360:Fancm UTSW 12 65075950 missense probably damaging 1.00
R0491:Fancm UTSW 12 65106061 missense probably benign 0.32
R0557:Fancm UTSW 12 65118442 critical splice donor site probably null
R0617:Fancm UTSW 12 65097317 nonsense probably null
R1201:Fancm UTSW 12 65106768 missense possibly damaging 0.66
R1353:Fancm UTSW 12 65088170 missense probably damaging 1.00
R1456:Fancm UTSW 12 65118351 missense possibly damaging 0.48
R1468:Fancm UTSW 12 65099293 missense probably damaging 1.00
R1468:Fancm UTSW 12 65099293 missense probably damaging 1.00
R1521:Fancm UTSW 12 65121704 missense probably benign 0.25
R1530:Fancm UTSW 12 65092490 critical splice donor site probably null
R1559:Fancm UTSW 12 65093689 missense probably benign 0.00
R1632:Fancm UTSW 12 65130331 missense probably damaging 1.00
R1681:Fancm UTSW 12 65105656 missense probably benign 0.03
R1919:Fancm UTSW 12 65105520 missense possibly damaging 0.48
R1969:Fancm UTSW 12 65101692 missense probably benign 0.09
R1971:Fancm UTSW 12 65101692 missense probably benign 0.09
R2117:Fancm UTSW 12 65077174 missense probably damaging 1.00
R2510:Fancm UTSW 12 65113770 splice site probably benign
R2909:Fancm UTSW 12 65124856 missense probably damaging 1.00
R3155:Fancm UTSW 12 65116421 missense probably benign 0.32
R3405:Fancm UTSW 12 65075772 missense probably benign 0.00
R4133:Fancm UTSW 12 65120530 missense probably benign 0.44
R4308:Fancm UTSW 12 65126531 missense probably benign 0.14
R4588:Fancm UTSW 12 65118441 critical splice donor site probably null
R4653:Fancm UTSW 12 65083054 missense probably damaging 0.99
R4702:Fancm UTSW 12 65122052 missense possibly damaging 0.95
R4719:Fancm UTSW 12 65121706 missense possibly damaging 0.64
R4885:Fancm UTSW 12 65102643 nonsense probably null
R4896:Fancm UTSW 12 65075831 missense probably damaging 1.00
R4908:Fancm UTSW 12 65094871 missense probably benign 0.28
R4921:Fancm UTSW 12 65077141 missense probably benign 0.19
R4922:Fancm UTSW 12 65106892 critical splice donor site probably null
R4948:Fancm UTSW 12 65090974 missense probably damaging 1.00
R5103:Fancm UTSW 12 65105858 missense probably damaging 0.99
R5577:Fancm UTSW 12 65130411 utr 3 prime probably benign
R5631:Fancm UTSW 12 65113843 missense probably damaging 0.97
R5741:Fancm UTSW 12 65101615 missense probably benign 0.01
R6137:Fancm UTSW 12 65130382 missense probably damaging 1.00
R6167:Fancm UTSW 12 65094895 missense probably benign 0.42
R6242:Fancm UTSW 12 65116442 missense probably benign 0.01
R6242:Fancm UTSW 12 65116449 missense probably benign 0.00
R6281:Fancm UTSW 12 65088270 missense probably damaging 1.00
R6325:Fancm UTSW 12 65125052 missense probably damaging 1.00
R6434:Fancm UTSW 12 65077168 missense probably damaging 1.00
R6493:Fancm UTSW 12 65097488 missense probably benign 0.04
R6542:Fancm UTSW 12 65097429 missense probably damaging 1.00
R6645:Fancm UTSW 12 65106100 missense probably damaging 0.99
R6878:Fancm UTSW 12 65116423 nonsense probably null
R7171:Fancm UTSW 12 65101620 missense probably damaging 0.99
R7172:Fancm UTSW 12 65106054 missense possibly damaging 0.95
R7498:Fancm UTSW 12 65099391 missense probably benign 0.01
R7585:Fancm UTSW 12 65106247 missense possibly damaging 0.62
R7610:Fancm UTSW 12 65105680 missense probably damaging 1.00
R7722:Fancm UTSW 12 65106461 missense probably damaging 1.00
R7740:Fancm UTSW 12 65126547 missense possibly damaging 0.90
Predicted Primers PCR Primer
(F):5'- GCATGCCCTGATGCTTATTCAG -3'
(R):5'- CACACATATCCTTTGAAACATGCTC -3'

Sequencing Primer
(F):5'- AGCTGGACTGTGACCCGTG -3'
(R):5'- TTGAAACATGCTCTGCAGGC -3'
Posted On2015-09-25