Incidental Mutation 'R4602:Ak7'
ID345737
Institutional Source Beutler Lab
Gene Symbol Ak7
Ensembl Gene ENSMUSG00000041323
Gene Nameadenylate kinase 7
Synonyms4930502N02Rik
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4602 (G1)
Quality Score225
Status Not validated
Chromosome12
Chromosomal Location105705976-105782447 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 105713575 bp
ZygosityHeterozygous
Amino Acid Change Valine to Methionine at position 123 (V123M)
Ref Sequence ENSEMBL: ENSMUSP00000043145 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040876]
Predicted Effect probably benign
Transcript: ENSMUST00000040876
AA Change: V123M

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000043145
Gene: ENSMUSG00000041323
AA Change: V123M

DomainStartEndE-ValueType
low complexity region 46 57 N/A INTRINSIC
Pfam:ADK 431 675 1.4e-9 PFAM
Pfam:Dpy-30 679 720 3.2e-23 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.7%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygous mice exhibit hydrocephalus, rhinitis, sperm defects and most die before 8 weeks of age. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700029J07Rik A T 8: 45,970,468 I69N probably damaging Het
Ahnak A G 19: 9,010,825 K3158E possibly damaging Het
Ankmy1 A T 1: 92,888,650 N247K probably benign Het
Atp1a1 A G 3: 101,586,943 V447A probably benign Het
Atp1a4 A C 1: 172,239,765 M600R probably damaging Het
Baat A G 4: 49,502,727 Y132H probably damaging Het
Ceacam15 A G 7: 16,671,981 V215A probably damaging Het
Celf2 G T 2: 6,586,020 N279K possibly damaging Het
Clec14a C T 12: 58,267,981 R285H probably benign Het
Ctnna1 T G 18: 35,179,827 I244R possibly damaging Het
D230025D16Rik C A 8: 105,246,888 N282K possibly damaging Het
Dcxr T A 11: 120,726,304 N105Y possibly damaging Het
Dnajc6 T C 4: 101,611,264 F166L probably damaging Het
Ercc3 G A 18: 32,245,571 A202T probably benign Het
Faf1 A G 4: 109,727,428 D67G probably benign Het
Fancm G A 12: 65,124,944 R1786H probably benign Het
Fnbp1 A G 2: 31,036,540 probably null Het
Frem2 A G 3: 53,547,807 L2116S possibly damaging Het
Gbp5 A G 3: 142,503,785 E164G probably benign Het
Gm4922 A T 10: 18,784,259 Y238* probably null Het
Gm8257 A G 14: 44,656,317 Y62H probably damaging Het
Grin2b A G 6: 135,778,741 F525S probably damaging Het
Hfe2 T G 3: 96,527,553 S203A probably benign Het
Hsd17b3 C A 13: 64,063,170 probably null Het
Ighv1-23 T A 12: 114,764,559 Q81L probably benign Het
Inpp4b T C 8: 81,969,535 V366A probably damaging Het
Jak1 G T 4: 101,179,594 A283D possibly damaging Het
Kmt2d G T 15: 98,850,259 probably benign Het
Mbtps1 A T 8: 119,535,347 D354E probably damaging Het
Mettl17 T C 14: 51,888,789 V218A probably damaging Het
Mrc2 G A 11: 105,348,431 probably null Het
Nfat5 C T 8: 107,367,223 Q699* probably null Het
Olfr1193 G A 2: 88,677,896 V14I probably benign Het
Olfr1193 T G 2: 88,678,179 V101G probably benign Het
Olfr868 C A 9: 20,101,244 H162N probably benign Het
Osbpl7 C A 11: 97,056,269 S265R possibly damaging Het
Pcdh15 A G 10: 74,594,214 T1258A probably damaging Het
Pcdh20 A T 14: 88,468,430 L478Q probably damaging Het
Pde11a A G 2: 76,158,333 V488A probably benign Het
Phactr1 A T 13: 43,094,965 E463D probably benign Het
Samd9l A T 6: 3,373,935 Y1109N probably damaging Het
Samd9l GAA GAAA 6: 3,373,937 probably null Het
Secisbp2l C T 2: 125,740,737 G933D possibly damaging Het
Serpinb12 T A 1: 106,949,153 D66E probably benign Het
Sgk2 G A 2: 162,994,754 probably null Het
Slco1a6 C A 6: 142,101,652 C404F probably benign Het
Spaca6 C T 17: 17,831,125 A21V probably damaging Het
Sphkap G T 1: 83,279,061 Y322* probably null Het
Sptlc3 G A 2: 139,636,680 V520I probably benign Het
Stox2 A G 8: 47,192,935 S497P probably damaging Het
Syt9 A T 7: 107,436,387 K204* probably null Het
Taf3 A G 2: 9,952,657 V233A probably damaging Het
Tbccd1 T C 16: 22,818,535 probably null Het
Tdrd5 T A 1: 156,284,374 T479S probably benign Het
Tex10 T C 4: 48,452,946 D671G probably benign Het
Tgtp2 T C 11: 49,058,984 T254A probably damaging Het
Tmtc2 T C 10: 105,413,530 Y114C probably benign Het
Tns2 C T 15: 102,108,934 R281C probably damaging Het
Ubac1 A T 2: 25,998,977 I402N probably damaging Het
Zmat1 A T X: 134,972,945 S566T probably damaging Homo
Other mutations in Ak7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01100:Ak7 APN 12 105713574 missense probably benign 0.06
IGL01859:Ak7 APN 12 105745297 missense probably null
IGL01939:Ak7 APN 12 105734924 missense probably benign 0.06
IGL03233:Ak7 APN 12 105761480 missense probably damaging 1.00
drizzle UTSW 12 105742332 missense probably damaging 1.00
R0453:Ak7 UTSW 12 105716048 missense probably damaging 0.98
R0538:Ak7 UTSW 12 105766617 missense probably damaging 1.00
R0619:Ak7 UTSW 12 105733511 missense probably damaging 1.00
R0724:Ak7 UTSW 12 105710254 missense probably benign 0.00
R1028:Ak7 UTSW 12 105710189 small deletion probably benign
R1112:Ak7 UTSW 12 105713572 missense probably benign
R1449:Ak7 UTSW 12 105742261 missense possibly damaging 0.72
R1523:Ak7 UTSW 12 105766608 missense probably benign 0.18
R1626:Ak7 UTSW 12 105768548 missense probably benign 0.23
R1737:Ak7 UTSW 12 105742332 missense probably damaging 1.00
R1795:Ak7 UTSW 12 105726223 nonsense probably null
R1971:Ak7 UTSW 12 105726245 missense probably damaging 0.98
R2020:Ak7 UTSW 12 105745332 splice site probably null
R2267:Ak7 UTSW 12 105747214 missense probably benign
R3918:Ak7 UTSW 12 105710256 missense probably benign 0.03
R4600:Ak7 UTSW 12 105713575 missense probably benign 0.00
R4601:Ak7 UTSW 12 105713575 missense probably benign 0.00
R4610:Ak7 UTSW 12 105713575 missense probably benign 0.00
R4611:Ak7 UTSW 12 105713575 missense probably benign 0.00
R4612:Ak7 UTSW 12 105761513 missense probably damaging 1.00
R4791:Ak7 UTSW 12 105710145 missense probably benign 0.05
R5523:Ak7 UTSW 12 105741082 nonsense probably null
R5911:Ak7 UTSW 12 105726212 missense probably damaging 1.00
R6066:Ak7 UTSW 12 105733491 missense possibly damaging 0.87
R6270:Ak7 UTSW 12 105768701 missense probably benign
R6767:Ak7 UTSW 12 105766607 missense probably damaging 0.98
R6960:Ak7 UTSW 12 105710244 missense probably benign
R7016:Ak7 UTSW 12 105781679 nonsense probably null
R7185:Ak7 UTSW 12 105742276 missense probably damaging 1.00
R7187:Ak7 UTSW 12 105745273 missense probably benign 0.00
R7204:Ak7 UTSW 12 105742243 missense probably benign
R7724:Ak7 UTSW 12 105716030 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCTGCAAAGGCTCCCTATGG -3'
(R):5'- AGGTCCATTCATTAGCACACAC -3'

Sequencing Primer
(F):5'- AAAGGCTCCCTATGGGACTC -3'
(R):5'- GAACTTTAGGCACTTCTCAGACCAG -3'
Posted On2015-09-25