Incidental Mutation 'R4602:Ctnna1'
ID345750
Institutional Source Beutler Lab
Gene Symbol Ctnna1
Ensembl Gene ENSMUSG00000037815
Gene Namecatenin (cadherin associated protein), alpha 1
Synonymsalpha E catenin, alpha(E)-catenin, 2010010M04Rik, Catna1
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4602 (G1)
Quality Score225
Status Not validated
Chromosome18
Chromosomal Location35118888-35254773 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 35179827 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Arginine at position 244 (I244R)
Ref Sequence ENSEMBL: ENSMUSP00000049007 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042345]
PDB Structure
CRYSTAL STRUCTURE OF THE ALPHA-CATENIN DIMERIZATION DOMAIN [X-RAY DIFFRACTION]
CRYSTAL STRUCTURE OF A CHIMERA OF BETA-CATENIN AND ALPHA-CATENIN [X-RAY DIFFRACTION]
alpha-catenin fragment, residues 385-651 [X-RAY DIFFRACTION]
Alpha-E-catenin is an autoinhibited molecule that co-activates vinculin [X-RAY DIFFRACTION]
Alpha-E-catenin is an autoinhibited molecule that co-activates vinculin [X-RAY DIFFRACTION]
Crystal structure of full-length mouse alphaE-catenin [X-RAY DIFFRACTION]
Predicted Effect possibly damaging
Transcript: ENSMUST00000042345
AA Change: I244R

PolyPhen 2 Score 0.916 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000049007
Gene: ENSMUSG00000037815
AA Change: I244R

DomainStartEndE-ValueType
Pfam:Vinculin 19 339 2.6e-99 PFAM
Pfam:Vinculin 333 867 3.3e-218 PFAM
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the catenin family of proteins that play an important role in cell adhesion process by connecting cadherins located on the plasma membrane to the actin filaments inside the cell. The encoded mechanosensing protein contains three vinculin homology domains and undergoes conformational changes in response to cytoskeletal tension, resulting in the reconfiguration of cadherin-actin filament connections. Certain mutations in this gene cause butterfly-shaped pigment dystrophy. [provided by RefSeq, May 2016]
PHENOTYPE: Homozygous mutation of this gene results in embryonic lethality at the blastocyst stage. A conditional knockout in surface epithelium results in defects in hair follicle development and epidermal morphogenesis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700029J07Rik A T 8: 45,970,468 I69N probably damaging Het
Ahnak A G 19: 9,010,825 K3158E possibly damaging Het
Ak7 G A 12: 105,713,575 V123M probably benign Het
Ankmy1 A T 1: 92,888,650 N247K probably benign Het
Atp1a1 A G 3: 101,586,943 V447A probably benign Het
Atp1a4 A C 1: 172,239,765 M600R probably damaging Het
Baat A G 4: 49,502,727 Y132H probably damaging Het
Ceacam15 A G 7: 16,671,981 V215A probably damaging Het
Celf2 G T 2: 6,586,020 N279K possibly damaging Het
Clec14a C T 12: 58,267,981 R285H probably benign Het
D230025D16Rik C A 8: 105,246,888 N282K possibly damaging Het
Dcxr T A 11: 120,726,304 N105Y possibly damaging Het
Dnajc6 T C 4: 101,611,264 F166L probably damaging Het
Ercc3 G A 18: 32,245,571 A202T probably benign Het
Faf1 A G 4: 109,727,428 D67G probably benign Het
Fancm G A 12: 65,124,944 R1786H probably benign Het
Fnbp1 A G 2: 31,036,540 probably null Het
Frem2 A G 3: 53,547,807 L2116S possibly damaging Het
Gbp5 A G 3: 142,503,785 E164G probably benign Het
Gm4922 A T 10: 18,784,259 Y238* probably null Het
Gm8257 A G 14: 44,656,317 Y62H probably damaging Het
Grin2b A G 6: 135,778,741 F525S probably damaging Het
Hfe2 T G 3: 96,527,553 S203A probably benign Het
Hsd17b3 C A 13: 64,063,170 probably null Het
Ighv1-23 T A 12: 114,764,559 Q81L probably benign Het
Inpp4b T C 8: 81,969,535 V366A probably damaging Het
Jak1 G T 4: 101,179,594 A283D possibly damaging Het
Kmt2d G T 15: 98,850,259 probably benign Het
Mbtps1 A T 8: 119,535,347 D354E probably damaging Het
Mettl17 T C 14: 51,888,789 V218A probably damaging Het
Mrc2 G A 11: 105,348,431 probably null Het
Nfat5 C T 8: 107,367,223 Q699* probably null Het
Olfr1193 G A 2: 88,677,896 V14I probably benign Het
Olfr1193 T G 2: 88,678,179 V101G probably benign Het
Olfr868 C A 9: 20,101,244 H162N probably benign Het
Osbpl7 C A 11: 97,056,269 S265R possibly damaging Het
Pcdh15 A G 10: 74,594,214 T1258A probably damaging Het
Pcdh20 A T 14: 88,468,430 L478Q probably damaging Het
Pde11a A G 2: 76,158,333 V488A probably benign Het
Phactr1 A T 13: 43,094,965 E463D probably benign Het
Samd9l A T 6: 3,373,935 Y1109N probably damaging Het
Samd9l GAA GAAA 6: 3,373,937 probably null Het
Secisbp2l C T 2: 125,740,737 G933D possibly damaging Het
Serpinb12 T A 1: 106,949,153 D66E probably benign Het
Sgk2 G A 2: 162,994,754 probably null Het
Slco1a6 C A 6: 142,101,652 C404F probably benign Het
Spaca6 C T 17: 17,831,125 A21V probably damaging Het
Sphkap G T 1: 83,279,061 Y322* probably null Het
Sptlc3 G A 2: 139,636,680 V520I probably benign Het
Stox2 A G 8: 47,192,935 S497P probably damaging Het
Syt9 A T 7: 107,436,387 K204* probably null Het
Taf3 A G 2: 9,952,657 V233A probably damaging Het
Tbccd1 T C 16: 22,818,535 probably null Het
Tdrd5 T A 1: 156,284,374 T479S probably benign Het
Tex10 T C 4: 48,452,946 D671G probably benign Het
Tgtp2 T C 11: 49,058,984 T254A probably damaging Het
Tmtc2 T C 10: 105,413,530 Y114C probably benign Het
Tns2 C T 15: 102,108,934 R281C probably damaging Het
Ubac1 A T 2: 25,998,977 I402N probably damaging Het
Zmat1 A T X: 134,972,945 S566T probably damaging Homo
Other mutations in Ctnna1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01634:Ctnna1 APN 18 35223448 missense probably damaging 0.97
IGL03068:Ctnna1 APN 18 35249732 missense possibly damaging 0.66
IGL03286:Ctnna1 APN 18 35175153 missense probably benign 0.37
PIT4458001:Ctnna1 UTSW 18 35175126 missense possibly damaging 0.65
R0282:Ctnna1 UTSW 18 35244122 missense possibly damaging 0.79
R1971:Ctnna1 UTSW 18 35154527 missense probably benign
R2117:Ctnna1 UTSW 18 35152625 missense possibly damaging 0.76
R2424:Ctnna1 UTSW 18 35253707 missense probably benign 0.00
R4812:Ctnna1 UTSW 18 35239477 missense probably damaging 1.00
R5120:Ctnna1 UTSW 18 35182554 critical splice donor site probably null
R5469:Ctnna1 UTSW 18 35239520 missense probably benign 0.00
R5607:Ctnna1 UTSW 18 35249742 missense probably benign 0.25
R5629:Ctnna1 UTSW 18 35249749 missense probably benign
R5824:Ctnna1 UTSW 18 35179886 missense probably benign
R5971:Ctnna1 UTSW 18 35154514 missense probably benign
R6191:Ctnna1 UTSW 18 35174355 missense probably damaging 1.00
R7065:Ctnna1 UTSW 18 35152616 missense probably benign
R7519:Ctnna1 UTSW 18 35174371 missense probably benign 0.02
R7624:Ctnna1 UTSW 18 35244844 missense probably benign 0.00
R7636:Ctnna1 UTSW 18 35223473 missense possibly damaging 0.92
R8086:Ctnna1 UTSW 18 35152660 missense possibly damaging 0.55
U15987:Ctnna1 UTSW 18 35154514 missense probably benign
X0021:Ctnna1 UTSW 18 35182545 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AGGCTACGTTAATGCAGTTGTG -3'
(R):5'- ACCAGTTATCTTTTGGCAGTTG -3'

Sequencing Primer
(F):5'- GTTGTGTCTTGATATGAATAGAACCC -3'
(R):5'- GTTGGTGAAGAGCCCAAACTTTCC -3'
Posted On2015-09-25