Incidental Mutation 'R4603:Cse1l'
ID 345761
Institutional Source Beutler Lab
Gene Symbol Cse1l
Ensembl Gene ENSMUSG00000002718
Gene Name chromosome segregation 1 like
Synonyms Cas, Xpo2, Capts, 2610100P18Rik
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R4603 (G1)
Quality Score 225
Status Not validated
Chromosome 2
Chromosomal Location 166747961-166788309 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 166786452 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 604 (V604A)
Ref Sequence ENSEMBL: ENSMUSP00000126757 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002790] [ENSMUST00000049412] [ENSMUST00000109235] [ENSMUST00000109236] [ENSMUST00000109238] [ENSMUST00000163437] [ENSMUST00000168599] [ENSMUST00000184390] [ENSMUST00000169290]
AlphaFold Q9ERK4
Predicted Effect probably benign
Transcript: ENSMUST00000002790
AA Change: V917A

PolyPhen 2 Score 0.090 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000002790
Gene: ENSMUSG00000002718
AA Change: V917A

DomainStartEndE-ValueType
IBN_N 29 102 2e-10 SMART
Pfam:Cse1 156 526 9.2e-169 PFAM
Pfam:CAS_CSE1 527 962 1.1e-181 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000049412
SMART Domains Protein: ENSMUSP00000042626
Gene: ENSMUSG00000039536

DomainStartEndE-ValueType
Blast:DSRM 1 73 5e-21 BLAST
DSRM 97 162 9.49e-21 SMART
DSRM 199 265 5.54e-22 SMART
PDB:4DKK|A 355 469 2e-69 PDB
Blast:DSRM 401 466 3e-15 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000109235
SMART Domains Protein: ENSMUSP00000104858
Gene: ENSMUSG00000039536

DomainStartEndE-ValueType
Blast:DSRM 1 73 5e-21 BLAST
DSRM 97 162 9.49e-21 SMART
DSRM 199 265 5.54e-22 SMART
PDB:4DKK|A 355 469 3e-69 PDB
Blast:DSRM 401 466 3e-15 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000109236
SMART Domains Protein: ENSMUSP00000104859
Gene: ENSMUSG00000039536

DomainStartEndE-ValueType
Blast:DSRM 1 73 4e-21 BLAST
DSRM 97 162 9.49e-21 SMART
DSRM 197 263 5.54e-22 SMART
PDB:4DKK|A 353 467 3e-69 PDB
Blast:DSRM 399 464 3e-15 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000109238
SMART Domains Protein: ENSMUSP00000104861
Gene: ENSMUSG00000039536

DomainStartEndE-ValueType
Blast:DSRM 1 73 5e-21 BLAST
DSRM 97 168 4.04e-15 SMART
DSRM 205 271 5.54e-22 SMART
Pfam:Staufen_C 364 475 5.9e-51 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129061
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142481
Predicted Effect probably benign
Transcript: ENSMUST00000163437
AA Change: V604A

PolyPhen 2 Score 0.090 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000126757
Gene: ENSMUSG00000002718
AA Change: V604A

DomainStartEndE-ValueType
Pfam:Cse1 1 237 7.9e-105 PFAM
Pfam:CAS_CSE1 225 649 2.3e-195 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000168599
AA Change: V861A

PolyPhen 2 Score 0.027 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000129983
Gene: ENSMUSG00000002718
AA Change: V861A

DomainStartEndE-ValueType
IBN_N 29 102 2e-10 SMART
Pfam:Cse1 156 256 8.6e-40 PFAM
Pfam:Cse1 255 470 7.3e-99 PFAM
Pfam:CAS_CSE1 471 906 1.3e-201 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000171410
Predicted Effect noncoding transcript
Transcript: ENSMUST00000172037
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145819
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149454
Predicted Effect noncoding transcript
Transcript: ENSMUST00000163917
Predicted Effect probably benign
Transcript: ENSMUST00000164974
SMART Domains Protein: ENSMUSP00000128515
Gene: ENSMUSG00000002718

DomainStartEndE-ValueType
Pfam:CAS_CSE1 24 72 5.4e-16 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000184390
SMART Domains Protein: ENSMUSP00000139039
Gene: ENSMUSG00000039536

DomainStartEndE-ValueType
Blast:DSRM 1 73 4e-21 BLAST
DSRM 97 168 4.04e-15 SMART
DSRM 205 271 5.54e-22 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000169290
SMART Domains Protein: ENSMUSP00000128376
Gene: ENSMUSG00000002718

DomainStartEndE-ValueType
IBN_N 29 102 2e-10 SMART
Pfam:Cse1 156 389 5.2e-102 PFAM
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Proteins that carry a nuclear localization signal (NLS) are transported into the nucleus by the importin-alpha/beta heterodimer. Importin-alpha binds the NLS, while importin-beta mediates translocation through the nuclear pore complex. After translocation, RanGTP binds importin-beta and displaces importin-alpha. Importin-alpha must then be returned to the cytoplasm, leaving the NLS protein behind. The protein encoded by this gene binds strongly to NLS-free importin-alpha, and this binding is released in the cytoplasm by the combined action of RANBP1 and RANGAP1. In addition, the encoded protein may play a role both in apoptosis and in cell proliferation. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Jan 2012]
PHENOTYPE: Embryos homozygous for a targeted null mutation die prior to E5.5 of development and are morphologically disorganized and lack identifiable structures. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810024B03Rik A G 2: 127,029,019 (GRCm39) V60A probably damaging Het
AAdacl4fm3 A G 4: 144,429,798 (GRCm39) V397A probably benign Het
Afg3l1 A G 8: 124,228,674 (GRCm39) T747A probably benign Het
Aldh4a1 T C 4: 139,370,740 (GRCm39) S408P probably damaging Het
Ank2 T C 3: 126,825,665 (GRCm39) T445A probably benign Het
Antxrl A G 14: 33,797,792 (GRCm39) E589G possibly damaging Het
Arhgef12 C T 9: 42,921,489 (GRCm39) G329R probably benign Het
Arsi G A 18: 61,049,723 (GRCm39) G202E probably benign Het
AY358078 T A 14: 52,063,532 (GRCm39) C393S possibly damaging Het
Bpnt2 T C 4: 4,767,878 (GRCm39) I299M probably damaging Het
Brca2 T A 5: 150,459,630 (GRCm39) C302S possibly damaging Het
Ccdc169 T A 3: 55,058,226 (GRCm39) M4K probably benign Het
Ccdc66 T C 14: 27,222,377 (GRCm39) N122S probably damaging Het
Cd226 T C 18: 89,225,343 (GRCm39) V80A probably damaging Het
Cdc73 T C 1: 143,553,595 (GRCm39) probably null Het
Cfap96 A T 8: 46,423,505 (GRCm39) I69N probably damaging Het
Cxcr1 G C 1: 74,231,896 (GRCm39) T42S probably benign Het
Dhx9 TCC TC 1: 153,342,797 (GRCm39) probably null Het
Ercc3 G A 18: 32,378,624 (GRCm39) A202T probably benign Het
Erp27 A G 6: 136,896,947 (GRCm39) V85A probably damaging Het
Fam3d T A 14: 8,358,429 (GRCm38) S57C probably damaging Het
Fgf8 T G 19: 45,726,592 (GRCm39) I137L probably benign Het
Fgfrl1 T A 5: 108,851,401 (GRCm39) V106D probably damaging Het
Gaa T C 11: 119,169,784 (GRCm39) W613R probably damaging Het
Gabarap A G 11: 69,885,287 (GRCm39) N66S probably benign Het
Gp1bb A T 16: 18,439,893 (GRCm39) L67Q probably damaging Het
Gpn1 T C 5: 31,654,696 (GRCm39) probably null Het
Gstt1 T C 10: 75,629,969 (GRCm39) Y48C probably damaging Het
Iqcg C T 16: 32,861,134 (GRCm39) R194K probably null Het
Iqcg C G 16: 32,861,133 (GRCm39) probably null Het
Kcnj3 C T 2: 55,336,991 (GRCm39) R286* probably null Het
Klhl38 T A 15: 58,186,616 (GRCm39) I38F possibly damaging Het
Kmo C A 1: 175,479,208 (GRCm39) P248Q probably benign Het
Mbtps1 A T 8: 120,262,086 (GRCm39) D354E probably damaging Het
Mcpt9 C T 14: 56,266,049 (GRCm39) V60M probably damaging Het
Mical3 C A 6: 120,911,799 (GRCm39) E1083* probably null Het
Mprip T C 11: 59,622,399 (GRCm39) V162A probably damaging Het
Mrc2 G A 11: 105,239,257 (GRCm39) probably null Het
Myocd T C 11: 65,078,571 (GRCm39) D408G possibly damaging Het
Myt1l A G 12: 29,892,539 (GRCm39) T59A probably benign Het
Ndufb7 A G 8: 84,293,494 (GRCm39) E16G probably damaging Het
Ndufs7 T A 10: 80,092,501 (GRCm39) Y203* probably null Het
Nploc4 C T 11: 120,276,613 (GRCm39) V478I probably benign Het
Nrap A G 19: 56,323,456 (GRCm39) probably null Het
Or5e1 A T 7: 108,354,834 (GRCm39) Y257F probably damaging Het
Or6c207 G A 10: 129,104,274 (GRCm39) A306V probably benign Het
Pald1 T C 10: 61,184,395 (GRCm39) T241A probably benign Het
Pdss2 T C 10: 43,248,197 (GRCm39) S234P probably damaging Het
Pias2 T A 18: 77,217,803 (GRCm39) V335E probably damaging Het
Ppip5k2 C A 1: 97,682,861 (GRCm39) K187N probably damaging Het
Ppp3cb T C 14: 20,570,714 (GRCm39) N339S possibly damaging Het
Ppp4r1 T G 17: 66,120,459 (GRCm39) C181G probably damaging Het
Pramel27 T A 4: 143,579,451 (GRCm39) H345Q probably benign Het
Prkdc G A 16: 15,628,688 (GRCm39) E3478K probably damaging Het
Prpf4b T C 13: 35,072,147 (GRCm39) probably benign Het
Psme3 T A 11: 101,208,435 (GRCm39) probably null Het
Ptpre C A 7: 135,269,372 (GRCm39) Y284* probably null Het
Scnn1a A G 6: 125,299,123 (GRCm39) I94V probably damaging Het
Secisbp2l C T 2: 125,582,657 (GRCm39) G933D possibly damaging Het
Shc2 T C 10: 79,459,690 (GRCm39) D418G probably benign Het
Sidt1 A T 16: 44,075,389 (GRCm39) D661E probably damaging Het
Slc35e2 T C 4: 155,702,106 (GRCm39) F290S probably benign Het
Sorcs1 A G 19: 50,301,402 (GRCm39) probably null Het
Stox2 A G 8: 47,645,970 (GRCm39) S497P probably damaging Het
Tmem270 C A 5: 134,930,482 (GRCm39) E260* probably null Het
Tmtc2 T C 10: 105,249,391 (GRCm39) Y114C probably benign Het
Trim46 A G 3: 89,150,958 (GRCm39) F188S probably benign Het
Trim7 T A 11: 48,728,355 (GRCm39) M1K probably null Het
Txnip A G 3: 96,465,604 (GRCm39) E18G probably benign Het
Usp34 A G 11: 23,414,633 (GRCm39) N2859D probably damaging Het
Vmn2r94 T A 17: 18,477,647 (GRCm39) I255F probably benign Het
Xkr5 T A 8: 18,983,733 (GRCm39) N603I possibly damaging Het
Zfp512 C T 5: 31,637,570 (GRCm39) A497V probably benign Het
Zfp518b T C 5: 38,830,970 (GRCm39) N345S probably damaging Het
Other mutations in Cse1l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00420:Cse1l APN 2 166,769,724 (GRCm39) missense probably damaging 1.00
IGL01306:Cse1l APN 2 166,769,428 (GRCm39) nonsense probably null
IGL01672:Cse1l APN 2 166,771,887 (GRCm39) missense probably damaging 1.00
IGL02060:Cse1l APN 2 166,772,573 (GRCm39) missense probably damaging 1.00
IGL02897:Cse1l APN 2 166,761,628 (GRCm39) missense possibly damaging 0.47
IGL03375:Cse1l APN 2 166,784,977 (GRCm39) splice site probably benign
ANU23:Cse1l UTSW 2 166,769,428 (GRCm39) nonsense probably null
PIT4585001:Cse1l UTSW 2 166,783,394 (GRCm39) missense probably damaging 1.00
R0195:Cse1l UTSW 2 166,782,008 (GRCm39) missense probably benign
R1114:Cse1l UTSW 2 166,783,123 (GRCm39) splice site probably benign
R1539:Cse1l UTSW 2 166,768,292 (GRCm39) missense probably benign 0.00
R1721:Cse1l UTSW 2 166,768,331 (GRCm39) missense probably damaging 1.00
R1779:Cse1l UTSW 2 166,782,044 (GRCm39) splice site probably null
R1913:Cse1l UTSW 2 166,764,111 (GRCm39) missense probably damaging 1.00
R2069:Cse1l UTSW 2 166,783,412 (GRCm39) missense probably benign 0.01
R2398:Cse1l UTSW 2 166,770,917 (GRCm39) missense probably damaging 1.00
R4110:Cse1l UTSW 2 166,783,970 (GRCm39) missense probably benign 0.00
R4195:Cse1l UTSW 2 166,771,899 (GRCm39) missense probably damaging 1.00
R4686:Cse1l UTSW 2 166,774,080 (GRCm39) missense probably damaging 1.00
R4867:Cse1l UTSW 2 166,768,323 (GRCm39) missense possibly damaging 0.76
R4942:Cse1l UTSW 2 166,771,714 (GRCm39) missense probably damaging 1.00
R5164:Cse1l UTSW 2 166,786,348 (GRCm39) missense probably benign 0.02
R5475:Cse1l UTSW 2 166,783,174 (GRCm39) missense probably damaging 1.00
R5493:Cse1l UTSW 2 166,783,110 (GRCm39) intron probably benign
R5782:Cse1l UTSW 2 166,770,921 (GRCm39) missense probably damaging 1.00
R5862:Cse1l UTSW 2 166,757,127 (GRCm39) missense probably benign 0.00
R6030:Cse1l UTSW 2 166,761,541 (GRCm39) missense probably benign 0.01
R6030:Cse1l UTSW 2 166,761,541 (GRCm39) missense probably benign 0.01
R6913:Cse1l UTSW 2 166,771,797 (GRCm39) missense possibly damaging 0.65
R7683:Cse1l UTSW 2 166,764,708 (GRCm39) missense probably benign
R7871:Cse1l UTSW 2 166,777,591 (GRCm39) splice site probably null
R8001:Cse1l UTSW 2 166,781,833 (GRCm39) missense probably damaging 1.00
R8057:Cse1l UTSW 2 166,781,845 (GRCm39) missense probably damaging 1.00
R8175:Cse1l UTSW 2 166,785,128 (GRCm39) critical splice donor site probably null
R8347:Cse1l UTSW 2 166,769,505 (GRCm39) missense possibly damaging 0.95
R8386:Cse1l UTSW 2 166,761,604 (GRCm39) missense probably benign 0.00
R8479:Cse1l UTSW 2 166,763,893 (GRCm39) missense possibly damaging 0.95
R8973:Cse1l UTSW 2 166,785,000 (GRCm39) missense probably damaging 1.00
R9206:Cse1l UTSW 2 166,783,185 (GRCm39) missense probably damaging 1.00
R9208:Cse1l UTSW 2 166,783,185 (GRCm39) missense probably damaging 1.00
R9522:Cse1l UTSW 2 166,776,673 (GRCm39) missense probably benign
R9599:Cse1l UTSW 2 166,783,386 (GRCm39) missense probably benign
R9600:Cse1l UTSW 2 166,757,119 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCTGCACTGTCCAATCCAGG -3'
(R):5'- GCTAAATGCAATTAAAGGTCCAGTC -3'

Sequencing Primer
(F):5'- AATCCAGGACTCCTTTGTTACAATC -3'
(R):5'- GTATAGTGCTAGCCATCCTGGAAC -3'
Posted On 2015-09-25