Incidental Mutation 'R4603:Cse1l'
ID 345761
Institutional Source Beutler Lab
Gene Symbol Cse1l
Ensembl Gene ENSMUSG00000002718
Gene Name chromosome segregation 1-like (S. cerevisiae)
Synonyms Capts, Xpo2, 2610100P18Rik, Cas
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R4603 (G1)
Quality Score 225
Status Not validated
Chromosome 2
Chromosomal Location 166906040-166946389 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 166944532 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 604 (V604A)
Ref Sequence ENSEMBL: ENSMUSP00000126757 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002790] [ENSMUST00000049412] [ENSMUST00000109235] [ENSMUST00000109236] [ENSMUST00000109238] [ENSMUST00000163437] [ENSMUST00000168599] [ENSMUST00000184390] [ENSMUST00000169290]
AlphaFold Q9ERK4
Predicted Effect probably benign
Transcript: ENSMUST00000002790
AA Change: V917A

PolyPhen 2 Score 0.090 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000002790
Gene: ENSMUSG00000002718
AA Change: V917A

DomainStartEndE-ValueType
IBN_N 29 102 2e-10 SMART
Pfam:Cse1 156 526 9.2e-169 PFAM
Pfam:CAS_CSE1 527 962 1.1e-181 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000049412
SMART Domains Protein: ENSMUSP00000042626
Gene: ENSMUSG00000039536

DomainStartEndE-ValueType
Blast:DSRM 1 73 5e-21 BLAST
DSRM 97 162 9.49e-21 SMART
DSRM 199 265 5.54e-22 SMART
PDB:4DKK|A 355 469 2e-69 PDB
Blast:DSRM 401 466 3e-15 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000109235
SMART Domains Protein: ENSMUSP00000104858
Gene: ENSMUSG00000039536

DomainStartEndE-ValueType
Blast:DSRM 1 73 5e-21 BLAST
DSRM 97 162 9.49e-21 SMART
DSRM 199 265 5.54e-22 SMART
PDB:4DKK|A 355 469 3e-69 PDB
Blast:DSRM 401 466 3e-15 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000109236
SMART Domains Protein: ENSMUSP00000104859
Gene: ENSMUSG00000039536

DomainStartEndE-ValueType
Blast:DSRM 1 73 4e-21 BLAST
DSRM 97 162 9.49e-21 SMART
DSRM 197 263 5.54e-22 SMART
PDB:4DKK|A 353 467 3e-69 PDB
Blast:DSRM 399 464 3e-15 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000109238
SMART Domains Protein: ENSMUSP00000104861
Gene: ENSMUSG00000039536

DomainStartEndE-ValueType
Blast:DSRM 1 73 5e-21 BLAST
DSRM 97 168 4.04e-15 SMART
DSRM 205 271 5.54e-22 SMART
Pfam:Staufen_C 364 475 5.9e-51 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129061
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142481
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145819
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149454
Predicted Effect probably benign
Transcript: ENSMUST00000163437
AA Change: V604A

PolyPhen 2 Score 0.090 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000126757
Gene: ENSMUSG00000002718
AA Change: V604A

DomainStartEndE-ValueType
Pfam:Cse1 1 237 7.9e-105 PFAM
Pfam:CAS_CSE1 225 649 2.3e-195 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000163917
Predicted Effect probably benign
Transcript: ENSMUST00000164974
SMART Domains Protein: ENSMUSP00000128515
Gene: ENSMUSG00000002718

DomainStartEndE-ValueType
Pfam:CAS_CSE1 24 72 5.4e-16 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000168599
AA Change: V861A

PolyPhen 2 Score 0.027 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000129983
Gene: ENSMUSG00000002718
AA Change: V861A

DomainStartEndE-ValueType
IBN_N 29 102 2e-10 SMART
Pfam:Cse1 156 256 8.6e-40 PFAM
Pfam:Cse1 255 470 7.3e-99 PFAM
Pfam:CAS_CSE1 471 906 1.3e-201 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000171410
Predicted Effect noncoding transcript
Transcript: ENSMUST00000172037
Predicted Effect probably benign
Transcript: ENSMUST00000184390
SMART Domains Protein: ENSMUSP00000139039
Gene: ENSMUSG00000039536

DomainStartEndE-ValueType
Blast:DSRM 1 73 4e-21 BLAST
DSRM 97 168 4.04e-15 SMART
DSRM 205 271 5.54e-22 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000169290
SMART Domains Protein: ENSMUSP00000128376
Gene: ENSMUSG00000002718

DomainStartEndE-ValueType
IBN_N 29 102 2e-10 SMART
Pfam:Cse1 156 389 5.2e-102 PFAM
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Proteins that carry a nuclear localization signal (NLS) are transported into the nucleus by the importin-alpha/beta heterodimer. Importin-alpha binds the NLS, while importin-beta mediates translocation through the nuclear pore complex. After translocation, RanGTP binds importin-beta and displaces importin-alpha. Importin-alpha must then be returned to the cytoplasm, leaving the NLS protein behind. The protein encoded by this gene binds strongly to NLS-free importin-alpha, and this binding is released in the cytoplasm by the combined action of RANBP1 and RANGAP1. In addition, the encoded protein may play a role both in apoptosis and in cell proliferation. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Jan 2012]
PHENOTYPE: Embryos homozygous for a targeted null mutation die prior to E5.5 of development and are morphologically disorganized and lack identifiable structures. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700029J07Rik A T 8: 45,970,468 I69N probably damaging Het
1810024B03Rik A G 2: 127,187,099 V60A probably damaging Het
Afg3l1 A G 8: 123,501,935 T747A probably benign Het
Aldh4a1 T C 4: 139,643,429 S408P probably damaging Het
Ank2 T C 3: 127,032,016 T445A probably benign Het
Antxrl A G 14: 34,075,835 E589G possibly damaging Het
Arhgef12 C T 9: 43,010,193 G329R probably benign Het
Arsi G A 18: 60,916,651 G202E probably benign Het
AY358078 T A 14: 51,826,075 C393S possibly damaging Het
Brca2 T A 5: 150,536,165 C302S possibly damaging Het
Ccdc169 T A 3: 55,150,805 M4K probably benign Het
Ccdc66 T C 14: 27,500,420 N122S probably damaging Het
Cd226 T C 18: 89,207,219 V80A probably damaging Het
Cdc73 T C 1: 143,677,857 probably null Het
Cxcr1 G C 1: 74,192,737 T42S probably benign Het
Dhx9 TCC TC 1: 153,467,051 probably null Het
Ercc3 G A 18: 32,245,571 A202T probably benign Het
Erp27 A G 6: 136,919,949 V85A probably damaging Het
Fgf8 T G 19: 45,738,153 I137L probably benign Het
Fgfrl1 T A 5: 108,703,535 V106D probably damaging Het
Gaa T C 11: 119,278,958 W613R probably damaging Het
Gabarap A G 11: 69,994,461 N66S probably benign Het
Gm13103 T A 4: 143,852,881 H345Q probably benign Het
Gm13178 A G 4: 144,703,228 V397A probably benign Het
Gp1bb A T 16: 18,621,143 L67Q probably damaging Het
Gpn1 T C 5: 31,497,352 probably null Het
Gstt1 T C 10: 75,794,135 Y48C probably damaging Het
Impad1 T C 4: 4,767,878 I299M probably damaging Het
Iqcg C T 16: 33,040,764 R194K probably null Het
Iqcg C G 16: 33,040,763 probably null Het
Kcnj3 C T 2: 55,446,979 R286* probably null Het
Klhl38 T A 15: 58,323,220 I38F possibly damaging Het
Kmo C A 1: 175,651,642 P248Q probably benign Het
Mbtps1 A T 8: 119,535,347 D354E probably damaging Het
Mcpt9 C T 14: 56,028,592 V60M probably damaging Het
Mical3 C A 6: 120,934,838 E1083* probably null Het
Mprip T C 11: 59,731,573 V162A probably damaging Het
Mrc2 G A 11: 105,348,431 probably null Het
Myocd T C 11: 65,187,745 D408G possibly damaging Het
Myt1l A G 12: 29,842,540 T59A probably benign Het
Ndufb7 A G 8: 83,566,865 E16G probably damaging Het
Ndufs7 T A 10: 80,256,667 Y203* probably null Het
Nploc4 C T 11: 120,385,787 V478I probably benign Het
Nrap A G 19: 56,335,024 probably null Het
Oit1 T A 14: 8,358,429 S57C probably damaging Het
Olfr513 A T 7: 108,755,627 Y257F probably damaging Het
Olfr777 G A 10: 129,268,405 A306V probably benign Het
Pald1 T C 10: 61,348,616 T241A probably benign Het
Pdss2 T C 10: 43,372,201 S234P probably damaging Het
Pias2 T A 18: 77,130,107 V335E probably damaging Het
Ppip5k2 C A 1: 97,755,136 K187N probably damaging Het
Ppp3cb T C 14: 20,520,646 N339S possibly damaging Het
Ppp4r1 T G 17: 65,813,464 C181G probably damaging Het
Prkdc G A 16: 15,810,824 E3478K probably damaging Het
Prpf4b T C 13: 34,888,164 probably benign Het
Psme3 T A 11: 101,317,609 probably null Het
Ptpre C A 7: 135,667,643 Y284* probably null Het
Scnn1a A G 6: 125,322,160 I94V probably damaging Het
Secisbp2l C T 2: 125,740,737 G933D possibly damaging Het
Shc2 T C 10: 79,623,856 D418G probably benign Het
Sidt1 A T 16: 44,255,026 D661E probably damaging Het
Slc35e2 T C 4: 155,617,649 F290S probably benign Het
Sorcs1 A G 19: 50,312,964 probably null Het
Stox2 A G 8: 47,192,935 S497P probably damaging Het
Tmem270 C A 5: 134,901,628 E260* probably null Het
Tmtc2 T C 10: 105,413,530 Y114C probably benign Het
Trim46 A G 3: 89,243,651 F188S probably benign Het
Trim7 T A 11: 48,837,528 M1K probably null Het
Txnip A G 3: 96,558,288 E18G probably benign Het
Usp34 A G 11: 23,464,633 N2859D probably damaging Het
Vmn2r94 T A 17: 18,257,385 I255F probably benign Het
Xkr5 T A 8: 18,933,717 N603I possibly damaging Het
Zfp512 C T 5: 31,480,226 A497V probably benign Het
Zfp518b T C 5: 38,673,627 N345S probably damaging Het
Other mutations in Cse1l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00420:Cse1l APN 2 166927804 missense probably damaging 1.00
IGL01306:Cse1l APN 2 166927508 nonsense probably null
IGL01672:Cse1l APN 2 166929967 missense probably damaging 1.00
IGL02060:Cse1l APN 2 166930653 missense probably damaging 1.00
IGL02897:Cse1l APN 2 166919708 missense possibly damaging 0.47
IGL03375:Cse1l APN 2 166943057 splice site probably benign
ANU23:Cse1l UTSW 2 166927508 nonsense probably null
PIT4585001:Cse1l UTSW 2 166941474 missense probably damaging 1.00
R0195:Cse1l UTSW 2 166940088 missense probably benign
R1114:Cse1l UTSW 2 166941203 splice site probably benign
R1539:Cse1l UTSW 2 166926372 missense probably benign 0.00
R1721:Cse1l UTSW 2 166926411 missense probably damaging 1.00
R1779:Cse1l UTSW 2 166940124 splice site probably null
R1913:Cse1l UTSW 2 166922191 missense probably damaging 1.00
R2069:Cse1l UTSW 2 166941492 missense probably benign 0.01
R2398:Cse1l UTSW 2 166928997 missense probably damaging 1.00
R4110:Cse1l UTSW 2 166942050 missense probably benign 0.00
R4195:Cse1l UTSW 2 166929979 missense probably damaging 1.00
R4686:Cse1l UTSW 2 166932160 missense probably damaging 1.00
R4867:Cse1l UTSW 2 166926403 missense possibly damaging 0.76
R4942:Cse1l UTSW 2 166929794 missense probably damaging 1.00
R5164:Cse1l UTSW 2 166944428 missense probably benign 0.02
R5475:Cse1l UTSW 2 166941254 missense probably damaging 1.00
R5493:Cse1l UTSW 2 166941190 intron probably benign
R5782:Cse1l UTSW 2 166929001 missense probably damaging 1.00
R5862:Cse1l UTSW 2 166915207 missense probably benign 0.00
R6030:Cse1l UTSW 2 166919621 missense probably benign 0.01
R6030:Cse1l UTSW 2 166919621 missense probably benign 0.01
R6913:Cse1l UTSW 2 166929877 missense possibly damaging 0.65
R7683:Cse1l UTSW 2 166922788 missense probably benign
R7871:Cse1l UTSW 2 166935671 splice site probably null
R8001:Cse1l UTSW 2 166939913 missense probably damaging 1.00
R8057:Cse1l UTSW 2 166939925 missense probably damaging 1.00
R8175:Cse1l UTSW 2 166943208 critical splice donor site probably null
R8347:Cse1l UTSW 2 166927585 missense possibly damaging 0.95
R8386:Cse1l UTSW 2 166919684 missense probably benign 0.00
R8479:Cse1l UTSW 2 166921973 missense possibly damaging 0.95
R8973:Cse1l UTSW 2 166943080 missense probably damaging 1.00
R9206:Cse1l UTSW 2 166941265 missense probably damaging 1.00
R9208:Cse1l UTSW 2 166941265 missense probably damaging 1.00
R9522:Cse1l UTSW 2 166934753 missense probably benign
R9599:Cse1l UTSW 2 166941466 missense probably benign
R9600:Cse1l UTSW 2 166915199 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCTGCACTGTCCAATCCAGG -3'
(R):5'- GCTAAATGCAATTAAAGGTCCAGTC -3'

Sequencing Primer
(F):5'- AATCCAGGACTCCTTTGTTACAATC -3'
(R):5'- GTATAGTGCTAGCCATCCTGGAAC -3'
Posted On 2015-09-25