Incidental Mutation 'R4603:Gpn1'
ID345774
Institutional Source Beutler Lab
Gene Symbol Gpn1
Ensembl Gene ENSMUSG00000064037
Gene NameGPN-loop GTPase 1
Synonyms2410004J02Rik, Xab1
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.963) question?
Stock #R4603 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location31494741-31512904 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to C at 31497352 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000076217 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000076949] [ENSMUST00000201053] [ENSMUST00000202394]
Predicted Effect probably null
Transcript: ENSMUST00000076949
SMART Domains Protein: ENSMUSP00000076217
Gene: ENSMUSG00000064037

DomainStartEndE-ValueType
AAA 18 182 9.44e-4 SMART
low complexity region 263 275 N/A INTRINSIC
low complexity region 330 344 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000117700
AA Change: Y83H

PolyPhen 2 Score 0.977 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000113826
Gene: ENSMUSG00000064037
AA Change: Y83H

DomainStartEndE-ValueType
Pfam:ATP_bind_1 24 87 1.8e-26 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000200870
Predicted Effect probably benign
Transcript: ENSMUST00000201053
SMART Domains Protein: ENSMUSP00000144015
Gene: ENSMUSG00000064037

DomainStartEndE-ValueType
Pfam:ATP_bind_1 24 73 1.2e-18 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000201177
Predicted Effect noncoding transcript
Transcript: ENSMUST00000201881
Predicted Effect noncoding transcript
Transcript: ENSMUST00000201942
Predicted Effect probably damaging
Transcript: ENSMUST00000202394
AA Change: Y83H

PolyPhen 2 Score 0.977 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000144105
Gene: ENSMUSG00000064037
AA Change: Y83H

DomainStartEndE-ValueType
Pfam:ATP_bind_1 24 87 1.8e-26 PFAM
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a guanosine triphosphatase enzyme. The encoded protein may play a role in DNA repair and may function in activation of transcription. Alternatively spliced transcript variants have been described. [provided by RefSeq, Feb 2009]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700029J07Rik A T 8: 45,970,468 I69N probably damaging Het
1810024B03Rik A G 2: 127,187,099 V60A probably damaging Het
Afg3l1 A G 8: 123,501,935 T747A probably benign Het
Aldh4a1 T C 4: 139,643,429 S408P probably damaging Het
Ank2 T C 3: 127,032,016 T445A probably benign Het
Antxrl A G 14: 34,075,835 E589G possibly damaging Het
Arhgef12 C T 9: 43,010,193 G329R probably benign Het
Arsi G A 18: 60,916,651 G202E probably benign Het
AY358078 T A 14: 51,826,075 C393S possibly damaging Het
Brca2 T A 5: 150,536,165 C302S possibly damaging Het
Ccdc169 T A 3: 55,150,805 M4K probably benign Het
Ccdc66 T C 14: 27,500,420 N122S probably damaging Het
Cd226 T C 18: 89,207,219 V80A probably damaging Het
Cdc73 T C 1: 143,677,857 probably null Het
Cse1l T C 2: 166,944,532 V604A probably benign Het
Cxcr1 G C 1: 74,192,737 T42S probably benign Het
Dhx9 TCC TC 1: 153,467,051 probably null Het
Ercc3 G A 18: 32,245,571 A202T probably benign Het
Erp27 A G 6: 136,919,949 V85A probably damaging Het
Fgf8 T G 19: 45,738,153 I137L probably benign Het
Fgfrl1 T A 5: 108,703,535 V106D probably damaging Het
Gaa T C 11: 119,278,958 W613R probably damaging Het
Gabarap A G 11: 69,994,461 N66S probably benign Het
Gm13103 T A 4: 143,852,881 H345Q probably benign Het
Gm13178 A G 4: 144,703,228 V397A probably benign Het
Gp1bb A T 16: 18,621,143 L67Q probably damaging Het
Gstt1 T C 10: 75,794,135 Y48C probably damaging Het
Impad1 T C 4: 4,767,878 I299M probably damaging Het
Iqcg C T 16: 33,040,764 R194K probably null Het
Iqcg C G 16: 33,040,763 probably null Het
Kcnj3 C T 2: 55,446,979 R286* probably null Het
Klhl38 T A 15: 58,323,220 I38F possibly damaging Het
Kmo C A 1: 175,651,642 P248Q probably benign Het
Mbtps1 A T 8: 119,535,347 D354E probably damaging Het
Mcpt9 C T 14: 56,028,592 V60M probably damaging Het
Mical3 C A 6: 120,934,838 E1083* probably null Het
Mprip T C 11: 59,731,573 V162A probably damaging Het
Mrc2 G A 11: 105,348,431 probably null Het
Myocd T C 11: 65,187,745 D408G possibly damaging Het
Myt1l A G 12: 29,842,540 T59A probably benign Het
Ndufb7 A G 8: 83,566,865 E16G probably damaging Het
Ndufs7 T A 10: 80,256,667 Y203* probably null Het
Nploc4 C T 11: 120,385,787 V478I probably benign Het
Nrap A G 19: 56,335,024 probably null Het
Oit1 T A 14: 8,358,429 S57C probably damaging Het
Olfr513 A T 7: 108,755,627 Y257F probably damaging Het
Olfr777 G A 10: 129,268,405 A306V probably benign Het
Pald1 T C 10: 61,348,616 T241A probably benign Het
Pdss2 T C 10: 43,372,201 S234P probably damaging Het
Pias2 T A 18: 77,130,107 V335E probably damaging Het
Ppip5k2 C A 1: 97,755,136 K187N probably damaging Het
Ppp3cb T C 14: 20,520,646 N339S possibly damaging Het
Ppp4r1 T G 17: 65,813,464 C181G probably damaging Het
Prkdc G A 16: 15,810,824 E3478K probably damaging Het
Prpf4b T C 13: 34,888,164 probably benign Het
Psme3 T A 11: 101,317,609 probably null Het
Ptpre C A 7: 135,667,643 Y284* probably null Het
Scnn1a A G 6: 125,322,160 I94V probably damaging Het
Secisbp2l C T 2: 125,740,737 G933D possibly damaging Het
Shc2 T C 10: 79,623,856 D418G probably benign Het
Sidt1 A T 16: 44,255,026 D661E probably damaging Het
Slc35e2 T C 4: 155,617,649 F290S probably benign Het
Sorcs1 A G 19: 50,312,964 probably null Het
Stox2 A G 8: 47,192,935 S497P probably damaging Het
Tmem270 C A 5: 134,901,628 E260* probably null Het
Tmtc2 T C 10: 105,413,530 Y114C probably benign Het
Trim46 A G 3: 89,243,651 F188S probably benign Het
Trim7 T A 11: 48,837,528 M1K probably null Het
Txnip A G 3: 96,558,288 E18G probably benign Het
Usp34 A G 11: 23,464,633 N2859D probably damaging Het
Vmn2r94 T A 17: 18,257,385 I255F probably benign Het
Xkr5 T A 8: 18,933,717 N603I possibly damaging Het
Zfp512 C T 5: 31,480,226 A497V probably benign Het
Zfp518b T C 5: 38,673,627 N345S probably damaging Het
Other mutations in Gpn1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01114:Gpn1 APN 5 31498401 missense probably damaging 0.99
IGL01431:Gpn1 APN 5 31507538 missense probably benign 0.00
IGL01673:Gpn1 APN 5 31494835 missense probably damaging 1.00
IGL01921:Gpn1 APN 5 31499268 missense probably damaging 0.99
IGL03243:Gpn1 APN 5 31510831 critical splice acceptor site probably null
IGL03343:Gpn1 APN 5 31504965 missense probably damaging 1.00
PIT4480001:Gpn1 UTSW 5 31497341 missense probably damaging 1.00
PIT4585001:Gpn1 UTSW 5 31509403 nonsense probably null
R0001:Gpn1 UTSW 5 31495617 splice site probably benign
R1301:Gpn1 UTSW 5 31503429 missense probably damaging 1.00
R1583:Gpn1 UTSW 5 31497338 missense possibly damaging 0.46
R1622:Gpn1 UTSW 5 31503404 missense possibly damaging 0.85
R2860:Gpn1 UTSW 5 31497320 missense probably damaging 1.00
R2861:Gpn1 UTSW 5 31497320 missense probably damaging 1.00
R4627:Gpn1 UTSW 5 31498393 nonsense probably null
R5927:Gpn1 UTSW 5 31500891 missense probably damaging 1.00
R6613:Gpn1 UTSW 5 31497352 critical splice donor site probably null
R6830:Gpn1 UTSW 5 31507488 missense probably benign 0.00
R7214:Gpn1 UTSW 5 31503417 missense probably damaging 1.00
R7372:Gpn1 UTSW 5 31501121 missense probably damaging 0.99
X0062:Gpn1 UTSW 5 31495593 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTCCTGGGGTACTACTTGGC -3'
(R):5'- GCATTGCTGAAATCTCTGATCTCTC -3'

Sequencing Primer
(F):5'- ACGGTGGCACTTGTACAATC -3'
(R):5'- AAGAGGGCGTCAGATCTCTTTAC -3'
Posted On2015-09-25