Incidental Mutation 'R4603:Stox2'
ID345788
Institutional Source Beutler Lab
Gene Symbol Stox2
Ensembl Gene ENSMUSG00000038143
Gene Namestorkhead box 2
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.230) question?
Stock #R4603 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location47180048-47446362 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 47192935 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 497 (S497P)
Ref Sequence ENSEMBL: ENSMUSP00000147477 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000079195] [ENSMUST00000110367] [ENSMUST00000209337] [ENSMUST00000210030] [ENSMUST00000210153] [ENSMUST00000211737] [ENSMUST00000211882]
Predicted Effect probably damaging
Transcript: ENSMUST00000079195
AA Change: S497P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000078190
Gene: ENSMUSG00000038143
AA Change: S497P

DomainStartEndE-ValueType
low complexity region 15 30 N/A INTRINSIC
Pfam:Stork_head 63 141 4.5e-35 PFAM
low complexity region 225 236 N/A INTRINSIC
low complexity region 352 377 N/A INTRINSIC
low complexity region 459 473 N/A INTRINSIC
low complexity region 654 674 N/A INTRINSIC
low complexity region 717 731 N/A INTRINSIC
low complexity region 783 795 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000110367
AA Change: S435P

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000105996
Gene: ENSMUSG00000038143
AA Change: S435P

DomainStartEndE-ValueType
Pfam:Stork_head 1 79 5.6e-35 PFAM
low complexity region 163 174 N/A INTRINSIC
low complexity region 290 315 N/A INTRINSIC
low complexity region 397 411 N/A INTRINSIC
low complexity region 592 612 N/A INTRINSIC
low complexity region 655 669 N/A INTRINSIC
low complexity region 721 733 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000209337
Predicted Effect probably damaging
Transcript: ENSMUST00000210030
AA Change: S435P

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
Predicted Effect probably benign
Transcript: ENSMUST00000210153
Predicted Effect probably damaging
Transcript: ENSMUST00000211737
AA Change: S497P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect possibly damaging
Transcript: ENSMUST00000211882
AA Change: S561P

PolyPhen 2 Score 0.827 (Sensitivity: 0.84; Specificity: 0.93)
Meta Mutation Damage Score 0.068 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a Storkhead-box_winged-helix domain containing protein. This protein is differentially expressed in decidual tissue and may be involved in the susceptibility to pre-eclampsia with fetal growth restriction. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Sep 2015]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700029J07Rik A T 8: 45,970,468 I69N probably damaging Het
1810024B03Rik A G 2: 127,187,099 V60A probably damaging Het
Afg3l1 A G 8: 123,501,935 T747A probably benign Het
Aldh4a1 T C 4: 139,643,429 S408P probably damaging Het
Ank2 T C 3: 127,032,016 T445A probably benign Het
Antxrl A G 14: 34,075,835 E589G possibly damaging Het
Arhgef12 C T 9: 43,010,193 G329R probably benign Het
Arsi G A 18: 60,916,651 G202E probably benign Het
AY358078 T A 14: 51,826,075 C393S possibly damaging Het
Brca2 T A 5: 150,536,165 C302S possibly damaging Het
Ccdc169 T A 3: 55,150,805 M4K probably benign Het
Ccdc66 T C 14: 27,500,420 N122S probably damaging Het
Cd226 T C 18: 89,207,219 V80A probably damaging Het
Cdc73 T C 1: 143,677,857 probably null Het
Cse1l T C 2: 166,944,532 V604A probably benign Het
Cxcr1 G C 1: 74,192,737 T42S probably benign Het
Dhx9 TCC TC 1: 153,467,051 probably null Het
Ercc3 G A 18: 32,245,571 A202T probably benign Het
Erp27 A G 6: 136,919,949 V85A probably damaging Het
Fgf8 T G 19: 45,738,153 I137L probably benign Het
Fgfrl1 T A 5: 108,703,535 V106D probably damaging Het
Gaa T C 11: 119,278,958 W613R probably damaging Het
Gabarap A G 11: 69,994,461 N66S probably benign Het
Gm13103 T A 4: 143,852,881 H345Q probably benign Het
Gm13178 A G 4: 144,703,228 V397A probably benign Het
Gp1bb A T 16: 18,621,143 L67Q probably damaging Het
Gpn1 T C 5: 31,497,352 probably null Het
Gstt1 T C 10: 75,794,135 Y48C probably damaging Het
Impad1 T C 4: 4,767,878 I299M probably damaging Het
Iqcg C T 16: 33,040,764 R194K probably null Het
Iqcg C G 16: 33,040,763 probably null Het
Kcnj3 C T 2: 55,446,979 R286* probably null Het
Klhl38 T A 15: 58,323,220 I38F possibly damaging Het
Kmo C A 1: 175,651,642 P248Q probably benign Het
Mbtps1 A T 8: 119,535,347 D354E probably damaging Het
Mcpt9 C T 14: 56,028,592 V60M probably damaging Het
Mical3 C A 6: 120,934,838 E1083* probably null Het
Mprip T C 11: 59,731,573 V162A probably damaging Het
Mrc2 G A 11: 105,348,431 probably null Het
Myocd T C 11: 65,187,745 D408G possibly damaging Het
Myt1l A G 12: 29,842,540 T59A probably benign Het
Ndufb7 A G 8: 83,566,865 E16G probably damaging Het
Ndufs7 T A 10: 80,256,667 Y203* probably null Het
Nploc4 C T 11: 120,385,787 V478I probably benign Het
Nrap A G 19: 56,335,024 probably null Het
Oit1 T A 14: 8,358,429 S57C probably damaging Het
Olfr513 A T 7: 108,755,627 Y257F probably damaging Het
Olfr777 G A 10: 129,268,405 A306V probably benign Het
Pald1 T C 10: 61,348,616 T241A probably benign Het
Pdss2 T C 10: 43,372,201 S234P probably damaging Het
Pias2 T A 18: 77,130,107 V335E probably damaging Het
Ppip5k2 C A 1: 97,755,136 K187N probably damaging Het
Ppp3cb T C 14: 20,520,646 N339S possibly damaging Het
Ppp4r1 T G 17: 65,813,464 C181G probably damaging Het
Prkdc G A 16: 15,810,824 E3478K probably damaging Het
Prpf4b T C 13: 34,888,164 probably benign Het
Psme3 T A 11: 101,317,609 probably null Het
Ptpre C A 7: 135,667,643 Y284* probably null Het
Scnn1a A G 6: 125,322,160 I94V probably damaging Het
Secisbp2l C T 2: 125,740,737 G933D possibly damaging Het
Shc2 T C 10: 79,623,856 D418G probably benign Het
Sidt1 A T 16: 44,255,026 D661E probably damaging Het
Slc35e2 T C 4: 155,617,649 F290S probably benign Het
Sorcs1 A G 19: 50,312,964 probably null Het
Tmem270 C A 5: 134,901,628 E260* probably null Het
Tmtc2 T C 10: 105,413,530 Y114C probably benign Het
Trim46 A G 3: 89,243,651 F188S probably benign Het
Trim7 T A 11: 48,837,528 M1K probably null Het
Txnip A G 3: 96,558,288 E18G probably benign Het
Usp34 A G 11: 23,464,633 N2859D probably damaging Het
Vmn2r94 T A 17: 18,257,385 I255F probably benign Het
Xkr5 T A 8: 18,933,717 N603I possibly damaging Het
Zfp512 C T 5: 31,480,226 A497V probably benign Het
Zfp518b T C 5: 38,673,627 N345S probably damaging Het
Other mutations in Stox2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02234:Stox2 APN 8 47193612 missense probably damaging 1.00
IGL02331:Stox2 APN 8 47191944 missense probably damaging 0.96
IGL02399:Stox2 APN 8 47186538 missense probably damaging 0.99
IGL03091:Stox2 APN 8 47193187 missense possibly damaging 0.66
IGL03143:Stox2 APN 8 47193804 missense possibly damaging 0.78
IGL03307:Stox2 APN 8 47194030 missense probably damaging 1.00
R0082:Stox2 UTSW 8 47203282 splice site probably benign
R0313:Stox2 UTSW 8 47192134 missense probably damaging 1.00
R0382:Stox2 UTSW 8 47203284 splice site probably benign
R0513:Stox2 UTSW 8 47193865 missense probably damaging 1.00
R0539:Stox2 UTSW 8 47194035 missense probably damaging 0.97
R0920:Stox2 UTSW 8 47193018 missense probably damaging 1.00
R1764:Stox2 UTSW 8 47194016 nonsense probably null
R1923:Stox2 UTSW 8 47193626 missense probably damaging 1.00
R2311:Stox2 UTSW 8 47191978 missense probably damaging 1.00
R3196:Stox2 UTSW 8 47192830 missense probably damaging 0.99
R3715:Stox2 UTSW 8 47413152 missense possibly damaging 0.90
R4300:Stox2 UTSW 8 47193992 nonsense probably null
R4534:Stox2 UTSW 8 47193379 missense probably damaging 1.00
R4600:Stox2 UTSW 8 47192935 missense probably damaging 1.00
R4601:Stox2 UTSW 8 47192935 missense probably damaging 1.00
R4602:Stox2 UTSW 8 47192935 missense probably damaging 1.00
R4610:Stox2 UTSW 8 47192935 missense probably damaging 1.00
R4624:Stox2 UTSW 8 47193816 missense probably damaging 1.00
R4672:Stox2 UTSW 8 47192106 missense probably damaging 1.00
R4888:Stox2 UTSW 8 47203163 missense probably damaging 1.00
R4944:Stox2 UTSW 8 47413265 missense possibly damaging 0.46
R5331:Stox2 UTSW 8 47413627 utr 5 prime probably benign
R5349:Stox2 UTSW 8 47287916 missense possibly damaging 0.70
R5367:Stox2 UTSW 8 47203225 missense probably damaging 1.00
R5471:Stox2 UTSW 8 47193513 missense probably damaging 0.96
R5561:Stox2 UTSW 8 47193006 missense probably damaging 1.00
R5630:Stox2 UTSW 8 47191890 missense probably damaging 1.00
R5719:Stox2 UTSW 8 47413137 nonsense probably null
R5733:Stox2 UTSW 8 47413137 nonsense probably null
R5996:Stox2 UTSW 8 47203147 missense possibly damaging 0.93
R6170:Stox2 UTSW 8 47192020 missense probably benign 0.02
R6458:Stox2 UTSW 8 47192044 missense possibly damaging 0.66
R6786:Stox2 UTSW 8 47186465 missense probably damaging 1.00
R6815:Stox2 UTSW 8 47193101 missense probably damaging 1.00
R6951:Stox2 UTSW 8 47203132 missense probably damaging 1.00
R7193:Stox2 UTSW 8 47186454 missense probably benign
R7330:Stox2 UTSW 8 47192236 missense possibly damaging 0.61
R7552:Stox2 UTSW 8 47203119 critical splice donor site probably null
X0027:Stox2 UTSW 8 47193840 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- TGCATACCTCTTTGTAGCTGGC -3'
(R):5'- ATGCATAGCAACACGAACGTG -3'

Sequencing Primer
(F):5'- CATACCTCTTTGTAGCTGGCAGAAG -3'
(R):5'- GAACGTGATCGAGTCCCATTTC -3'
Posted On2015-09-25