Incidental Mutation 'R4604:Abcb6'
ID345834
Institutional Source Beutler Lab
Gene Symbol Abcb6
Ensembl Gene ENSMUSG00000026198
Gene NameATP-binding cassette, sub-family B (MDR/TAP), member 6
Synonyms1200005B17Rik
MMRRC Submission 041816-MU
Accession Numbers

Genbank: NM_023732.2; Ensembl: ENSMUST00000027396, ENSMUST00000161215

Is this an essential gene? Possibly non essential (E-score: 0.295) question?
Stock #R4604 (G1)
Quality Score190
Status Not validated
Chromosome1
Chromosomal Location75171717-75180392 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 75179877 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 81 (T81I)
Ref Sequence ENSEMBL: ENSMUSP00000027396 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027396] [ENSMUST00000040689] [ENSMUST00000188347] [ENSMUST00000189665] [ENSMUST00000189702]
Predicted Effect probably benign
Transcript: ENSMUST00000027396
AA Change: T81I

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000027396
Gene: ENSMUSG00000026198
AA Change: T81I

DomainStartEndE-ValueType
Pfam:MTABC_N 6 255 7.8e-80 PFAM
Pfam:ABC_membrane 265 544 3.7e-34 PFAM
AAA 615 816 1.29e-19 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000040689
SMART Domains Protein: ENSMUSP00000047449
Gene: ENSMUSG00000033124

DomainStartEndE-ValueType
transmembrane domain 70 92 N/A INTRINSIC
transmembrane domain 126 148 N/A INTRINSIC
Pfam:APG9 173 530 3.4e-134 PFAM
low complexity region 588 599 N/A INTRINSIC
low complexity region 607 621 N/A INTRINSIC
Blast:HELICc 692 733 1e-13 BLAST
low complexity region 734 755 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159219
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160081
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160757
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161103
Predicted Effect noncoding transcript
Transcript: ENSMUST00000185727
Predicted Effect probably benign
Transcript: ENSMUST00000187785
Predicted Effect probably benign
Transcript: ENSMUST00000188347
SMART Domains Protein: ENSMUSP00000139731
Gene: ENSMUSG00000033124

DomainStartEndE-ValueType
transmembrane domain 70 92 N/A INTRINSIC
transmembrane domain 126 148 N/A INTRINSIC
Pfam:APG9 172 533 2.4e-140 PFAM
low complexity region 588 599 N/A INTRINSIC
low complexity region 607 621 N/A INTRINSIC
Blast:HELICc 692 733 1e-13 BLAST
low complexity region 734 755 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000189665
SMART Domains Protein: ENSMUSP00000140012
Gene: ENSMUSG00000033124

DomainStartEndE-ValueType
transmembrane domain 70 92 N/A INTRINSIC
transmembrane domain 126 148 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000189702
SMART Domains Protein: ENSMUSP00000139641
Gene: ENSMUSG00000033124

DomainStartEndE-ValueType
transmembrane domain 70 92 N/A INTRINSIC
transmembrane domain 126 148 N/A INTRINSIC
Pfam:APG9 172 533 2.4e-140 PFAM
low complexity region 588 599 N/A INTRINSIC
low complexity region 607 621 N/A INTRINSIC
Blast:HELICc 692 733 1e-13 BLAST
low complexity region 734 755 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000189820
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The membrane-associated protein encoded by this gene is a member of the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra- and intra-cellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, White). This protein is a member of the MDR/TAP subfamily. Members of the MDR/TAP subfamily are involved in multidrug resistance as well as antigen presentation. This half-transporter likely plays a role in mitochondrial function. Localized to 2q26, this gene is considered a candidate gene for lethal neonatal metabolic syndrome, a disorder of mitochondrial function. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null mutation display partial lethality, impaired stress erythropoiesis, and absence of ATP-dependent transport of Coproporphyrin III in mitochondria. [provided by MGI curators]
Allele List at MGI

All alleles(2) : Targeted, other(2)

Other mutations in this stock
Total: 106 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930518I15Rik C T 2: 156,857,154 probably benign Het
Acp6 A G 3: 97,175,759 K362R probably benign Het
Adam26a A G 8: 43,570,051 M134T probably benign Het
Ankrd27 C T 7: 35,628,490 P812S probably damaging Het
Arl6ip1 AAAATAAATAAATAAATAAATAAATA AAAATAAATAAATAAATAAATAAATAAATA 7: 118,121,899 probably benign Het
Atp2a1 G A 7: 126,448,623 R672C probably damaging Het
Atxn2 G T 5: 121,781,343 W371C probably damaging Het
B3gnt2 T TTCACAAA 11: 22,836,426 probably null Het
Btnl6 T A 17: 34,508,461 D365V possibly damaging Het
Ccdc80 T A 16: 45,095,565 L228Q probably damaging Het
Cdc42bpa A G 1: 180,109,194 H718R probably benign Het
Cdh18 A G 15: 23,474,368 K775E probably benign Het
Cdh23 T G 10: 60,337,666 N1679T possibly damaging Het
Cep192 T A 18: 67,815,922 D271E possibly damaging Het
Cfap70 G T 14: 20,443,661 T124K probably benign Het
Ckap5 A T 2: 91,578,131 E890D probably benign Het
Col22a1 G T 15: 71,952,339 P569T probably benign Het
Colq A T 14: 31,545,103 L150Q possibly damaging Het
Csf1 T C 3: 107,756,962 probably null Het
Csmd3 A T 15: 48,004,815 S770T possibly damaging Het
Cul9 C A 17: 46,530,146 V733L probably damaging Het
Cyp2c55 A G 19: 39,031,386 D256G possibly damaging Het
D17Wsu92e T C 17: 27,820,315 D7G probably damaging Het
Dclk3 A T 9: 111,469,185 D599V probably damaging Het
Defb26 T A 2: 152,508,184 I59F possibly damaging Het
Dnah6 A G 6: 73,129,660 V1646A possibly damaging Het
Dnm2 T C 9: 21,504,664 probably null Het
Dock6 A G 9: 21,802,540 L1867P probably damaging Het
Dock9 G T 14: 121,668,459 T93K probably damaging Het
Dync2h1 T C 9: 7,140,995 H1344R probably benign Het
Enam A C 5: 88,504,283 Q1217P possibly damaging Het
Fbf1 A T 11: 116,158,922 D91E possibly damaging Het
Fbxo7 T G 10: 86,046,802 W393G probably damaging Het
Gab2 A G 7: 97,304,213 T599A probably damaging Het
Gfy T A 7: 45,177,188 I409F possibly damaging Het
Gm19345 T A 7: 19,857,508 probably null Het
Gm4787 A G 12: 81,379,213 M57T probably benign Het
Gper1 A G 5: 139,426,725 E275G probably damaging Het
Grik4 T C 9: 42,524,586 E803G probably damaging Het
Gstm3 G A 3: 107,968,197 P39L possibly damaging Het
Hax1 A T 3: 89,997,460 V142D probably damaging Het
Hcn3 A T 3: 89,150,440 I383N probably damaging Het
Hdac10 C A 15: 89,125,397 probably null Het
Hipk3 A C 2: 104,439,329 M505R probably damaging Het
Hivep1 C T 13: 42,159,749 P1822S probably benign Het
Hsd17b13 G T 5: 103,956,258 H281N unknown Het
Irak2 T A 6: 113,672,887 I222N probably damaging Het
Kalrn G A 16: 34,513,926 L7F possibly damaging Het
Kcnma1 A G 14: 23,309,038 probably null Het
Kcnn3 G T 3: 89,520,420 probably benign Het
Lamb1 A C 12: 31,278,776 D218A probably damaging Het
Lrrtm1 A T 6: 77,244,144 N195Y probably damaging Het
Ltf A T 9: 111,022,341 N72I probably damaging Het
Mcm4 A G 16: 15,629,663 I479T probably damaging Het
Mfhas1 T C 8: 35,588,610 S80P probably benign Het
Mknk1 A G 4: 115,878,027 E364G probably damaging Het
Msh4 C T 3: 153,872,283 C458Y probably damaging Het
Mtrr A T 13: 68,564,512 probably null Het
Myo1a T C 10: 127,711,138 W356R probably damaging Het
Nbea A G 3: 55,723,648 V2186A probably benign Het
Nfe2l3 T C 6: 51,451,012 S185P probably damaging Het
Nhsl1 A C 10: 18,531,410 K1397Q probably damaging Het
Nmbr C T 10: 14,770,164 R261W probably damaging Het
Npy2r A G 3: 82,541,058 S137P probably damaging Het
Obscn C T 11: 59,080,205 G2494D probably damaging Het
Obscn T C 11: 59,122,746 K1092E probably damaging Het
Olfr1019 C T 2: 85,841,182 C203Y probably damaging Het
Oosp2 A C 19: 11,649,683 I92S probably benign Het
Pcdh9 T C 14: 93,887,180 D518G probably damaging Het
Pde11a G T 2: 76,337,793 T272K possibly damaging Het
Plekha2 T A 8: 25,059,835 Q162L probably null Het
Prkag2 T A 5: 24,878,734 I84F probably damaging Het
Prm2 G T 16: 10,791,749 probably benign Het
Prpf40a A T 2: 53,142,023 C800S probably damaging Het
Prr5l A T 2: 101,729,448 C158S probably benign Het
Prrt3 C A 6: 113,498,237 C8F possibly damaging Het
Psg25 T C 7: 18,529,803 T32A probably benign Het
Ruvbl1 T C 6: 88,485,905 V337A probably benign Het
Sall1 T A 8: 89,030,341 Q1045L probably damaging Het
Sec22c T C 9: 121,695,642 Y25C probably damaging Het
Serpina3i A T 12: 104,267,777 T335S possibly damaging Het
Setd1b TCCACCACCACCACCACCACCACCA TCCACCACCACCACCACCACCA 5: 123,152,074 probably benign Het
Slc12a8 T A 16: 33,608,159 I279N probably damaging Het
Slc15a1 G A 14: 121,489,907 T83I probably damaging Het
Slc22a3 A G 17: 12,459,771 F222S probably benign Het
Sorcs3 A T 19: 48,693,914 T463S probably benign Het
Spsb4 C A 9: 96,995,878 A131S probably benign Het
Syne2 A G 12: 75,967,710 E3225G probably damaging Het
Tchp G A 5: 114,719,573 probably null Het
Tekt4 T A 17: 25,471,775 D18E probably benign Het
Timm50 A G 7: 28,311,018 V37A probably benign Het
Tlx2 A C 6: 83,068,760 *285G probably null Het
Tmem173 T A 18: 35,738,690 I170F probably damaging Het
Tshz1 C A 18: 84,013,374 D970Y probably damaging Het
Ttn A T 2: 76,870,461 V50E probably damaging Het
Txndc17 T A 11: 72,209,448 S113T probably benign Het
Tyk2 T C 9: 21,108,009 Y1039C probably damaging Het
Ubqln3 A G 7: 104,142,491 S131P probably benign Het
Uncx A T 5: 139,544,082 H30L possibly damaging Het
Usp25 T A 16: 77,115,415 D1007E probably damaging Het
Usp47 T C 7: 112,101,831 V1083A probably damaging Het
Wdr24 T A 17: 25,828,505 H765Q probably damaging Het
Wrnip1 A G 13: 32,802,347 D37G probably damaging Het
Xpo6 T C 7: 126,113,752 T686A possibly damaging Het
Zfp941 G A 7: 140,812,211 R412C probably damaging Het
Znrf2 T A 6: 54,878,440 C71* probably null Het
Other mutations in Abcb6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02836:Abcb6 APN 1 75178002 missense probably damaging 0.96
1mM(1):Abcb6 UTSW 1 75172111 unclassified probably benign
R0035:Abcb6 UTSW 1 75175007 missense possibly damaging 0.74
R0699:Abcb6 UTSW 1 75171909 missense probably damaging 0.98
R1470:Abcb6 UTSW 1 75172679 unclassified probably benign
R1595:Abcb6 UTSW 1 75177300 unclassified probably null
R1912:Abcb6 UTSW 1 75179955 missense probably benign
R2078:Abcb6 UTSW 1 75172136 missense probably damaging 1.00
R3105:Abcb6 UTSW 1 75175043 unclassified probably benign
R4015:Abcb6 UTSW 1 75174491 unclassified probably null
R4633:Abcb6 UTSW 1 75177782 unclassified probably benign
R4748:Abcb6 UTSW 1 75177358 missense probably damaging 1.00
R5530:Abcb6 UTSW 1 75177912 unclassified probably benign
R5654:Abcb6 UTSW 1 75174835 unclassified probably null
R5841:Abcb6 UTSW 1 75174350 missense possibly damaging 0.88
R6275:Abcb6 UTSW 1 75172551 splice site probably null
R6527:Abcb6 UTSW 1 75177488 critical splice acceptor site probably null
R7188:Abcb6 UTSW 1 75174137 critical splice donor site probably null
R7278:Abcb6 UTSW 1 75174373 missense possibly damaging 0.88
R7451:Abcb6 UTSW 1 75172153 missense probably damaging 1.00
R7481:Abcb6 UTSW 1 75173604 missense probably damaging 1.00
R7608:Abcb6 UTSW 1 75177703 missense probably benign 0.01
X0009:Abcb6 UTSW 1 75174553 missense probably benign 0.35
Predicted Primers PCR Primer
(F):5'- GACCCAAGCTATGCCTGAAC -3'
(R):5'- GCTTGGACTCAGAATGGCTTG -3'

Sequencing Primer
(F):5'- TATGCCTGAACTTCATCCAGACG -3'
(R):5'- ACTCAGAATGGCTTGAGTCC -3'
Posted On2015-09-25