Incidental Mutation 'R4604:Cdc42bpa'
ID345836
Institutional Source Beutler Lab
Gene Symbol Cdc42bpa
Ensembl Gene ENSMUSG00000026490
Gene NameCDC42 binding protein kinase alpha
SynonymsA930014J19Rik, DMPK-like
MMRRC Submission 041816-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.478) question?
Stock #R4604 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location179960472-180165603 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 180109194 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Arginine at position 718 (H718R)
Ref Sequence ENSEMBL: ENSMUSP00000075980 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000076687] [ENSMUST00000097450] [ENSMUST00000097453] [ENSMUST00000111117] [ENSMUST00000134959] [ENSMUST00000135056] [ENSMUST00000212756]
Predicted Effect probably benign
Transcript: ENSMUST00000076687
AA Change: H718R

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000075980
Gene: ENSMUSG00000026490
AA Change: H718R

DomainStartEndE-ValueType
S_TKc 77 343 1.06e-86 SMART
S_TK_X 344 406 1.18e-15 SMART
coiled coil region 435 588 N/A INTRINSIC
coiled coil region 632 735 N/A INTRINSIC
Pfam:DMPK_coil 800 860 2.7e-29 PFAM
C1 919 968 4.09e-7 SMART
PH 989 1109 6.02e-8 SMART
CNH 1134 1411 3.37e-17 SMART
low complexity region 1456 1468 N/A INTRINSIC
PBD 1477 1512 2.05e-10 SMART
low complexity region 1531 1546 N/A INTRINSIC
low complexity region 1567 1580 N/A INTRINSIC
low complexity region 1606 1620 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000097450
AA Change: H799R

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000095059
Gene: ENSMUSG00000026490
AA Change: H799R

DomainStartEndE-ValueType
S_TKc 77 343 1.06e-86 SMART
S_TK_X 344 406 1.18e-15 SMART
coiled coil region 435 669 N/A INTRINSIC
coiled coil region 713 816 N/A INTRINSIC
Pfam:DMPK_coil 881 941 2.2e-29 PFAM
C1 1000 1049 4.09e-7 SMART
PH 1070 1190 6.02e-8 SMART
CNH 1215 1492 3.37e-17 SMART
low complexity region 1537 1549 N/A INTRINSIC
PBD 1558 1593 2.05e-10 SMART
low complexity region 1612 1627 N/A INTRINSIC
low complexity region 1648 1661 N/A INTRINSIC
low complexity region 1687 1701 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000097453
AA Change: H799R

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000095062
Gene: ENSMUSG00000026490
AA Change: H799R

DomainStartEndE-ValueType
S_TKc 77 343 1.06e-86 SMART
S_TK_X 344 406 1.18e-15 SMART
coiled coil region 435 669 N/A INTRINSIC
coiled coil region 713 816 N/A INTRINSIC
Pfam:DMPK_coil 881 941 2.5e-29 PFAM
C1 972 1021 4.09e-7 SMART
PH 1042 1162 6.02e-8 SMART
CNH 1187 1464 3.37e-17 SMART
low complexity region 1509 1521 N/A INTRINSIC
PBD 1530 1565 2.05e-10 SMART
low complexity region 1584 1599 N/A INTRINSIC
low complexity region 1620 1633 N/A INTRINSIC
low complexity region 1659 1673 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000111117
AA Change: H799R

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000106746
Gene: ENSMUSG00000026490
AA Change: H799R

DomainStartEndE-ValueType
S_TKc 77 343 1.06e-86 SMART
S_TK_X 344 406 1.18e-15 SMART
low complexity region 484 499 N/A INTRINSIC
Pfam:KELK 529 608 1.1e-32 PFAM
coiled coil region 713 816 N/A INTRINSIC
Pfam:DMPK_coil 881 941 2.6e-29 PFAM
C1 1013 1062 4.09e-7 SMART
PH 1083 1203 6.02e-8 SMART
CNH 1228 1505 3.37e-17 SMART
low complexity region 1550 1562 N/A INTRINSIC
PBD 1571 1606 2.05e-10 SMART
low complexity region 1625 1640 N/A INTRINSIC
low complexity region 1661 1674 N/A INTRINSIC
low complexity region 1700 1714 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000133890
AA Change: H92R
SMART Domains Protein: ENSMUSP00000116337
Gene: ENSMUSG00000026490
AA Change: H92R

DomainStartEndE-ValueType
coiled coil region 6 109 N/A INTRINSIC
Pfam:DMPK_coil 175 235 1.4e-29 PFAM
C1 329 378 4.09e-7 SMART
PH 399 519 6.02e-8 SMART
CNH 544 821 3.37e-17 SMART
low complexity region 866 878 N/A INTRINSIC
PBD 887 922 2.05e-10 SMART
low complexity region 941 956 N/A INTRINSIC
low complexity region 977 990 N/A INTRINSIC
low complexity region 1016 1030 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000134959
SMART Domains Protein: ENSMUSP00000142018
Gene: ENSMUSG00000026490

DomainStartEndE-ValueType
PDB:4AW2|A 2 90 1e-58 PDB
SCOP:d1koba_ 50 90 7e-5 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000135056
SMART Domains Protein: ENSMUSP00000114333
Gene: ENSMUSG00000026490

DomainStartEndE-ValueType
Pfam:DMPK_coil 59 119 9e-30 PFAM
low complexity region 148 156 N/A INTRINSIC
C1 229 278 4.09e-7 SMART
PH 299 419 6.02e-8 SMART
CNH 444 721 3.37e-17 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143161
Predicted Effect unknown
Transcript: ENSMUST00000143176
AA Change: H1R
SMART Domains Protein: ENSMUSP00000115261
Gene: ENSMUSG00000026490
AA Change: H1R

DomainStartEndE-ValueType
Pfam:DMPK_coil 84 144 1.3e-29 PFAM
C1 203 252 4.09e-7 SMART
PH 273 393 6.02e-8 SMART
CNH 418 695 3.37e-17 SMART
low complexity region 740 752 N/A INTRINSIC
PBD 761 796 1.02e-5 SMART
PBD 802 839 2.21e-1 SMART
low complexity region 877 892 N/A INTRINSIC
low complexity region 913 926 N/A INTRINSIC
low complexity region 952 966 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000145181
SMART Domains Protein: ENSMUSP00000118039
Gene: ENSMUSG00000026490

DomainStartEndE-ValueType
Pfam:DMPK_coil 30 90 1e-30 PFAM
low complexity region 119 127 N/A INTRINSIC
SCOP:d1faq__ 163 185 2e-4 SMART
Blast:C1 165 185 1e-7 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152582
Predicted Effect noncoding transcript
Transcript: ENSMUST00000194974
Predicted Effect probably benign
Transcript: ENSMUST00000212756
AA Change: H799R

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the Serine/Threonine protein kinase family. This kinase contains multiple functional domains. Its kinase domain is highly similar to that of the myotonic dystrophy protein kinase (DMPK). This kinase also contains a Rac interactive binding (CRIB) domain, and has been shown to bind CDC42. It may function as a CDC42 downstream effector mediating CDC42 induced peripheral actin formation, and promoting cytoskeletal reorganization. Multiple alternatively spliced transcript variants have been described, and the full-length nature of two of them has been reported. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 106 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930518I15Rik C T 2: 156,857,154 probably benign Het
Abcb6 G A 1: 75,179,877 T81I probably benign Het
Acp6 A G 3: 97,175,759 K362R probably benign Het
Adam26a A G 8: 43,570,051 M134T probably benign Het
Ankrd27 C T 7: 35,628,490 P812S probably damaging Het
Arl6ip1 AAAATAAATAAATAAATAAATAAATA AAAATAAATAAATAAATAAATAAATAAATA 7: 118,121,899 probably benign Het
Atp2a1 G A 7: 126,448,623 R672C probably damaging Het
Atxn2 G T 5: 121,781,343 W371C probably damaging Het
B3gnt2 T TTCACAAA 11: 22,836,426 probably null Het
Btnl6 T A 17: 34,508,461 D365V possibly damaging Het
Ccdc80 T A 16: 45,095,565 L228Q probably damaging Het
Cdh18 A G 15: 23,474,368 K775E probably benign Het
Cdh23 T G 10: 60,337,666 N1679T possibly damaging Het
Cep192 T A 18: 67,815,922 D271E possibly damaging Het
Cfap70 G T 14: 20,443,661 T124K probably benign Het
Ckap5 A T 2: 91,578,131 E890D probably benign Het
Col22a1 G T 15: 71,952,339 P569T probably benign Het
Colq A T 14: 31,545,103 L150Q possibly damaging Het
Csf1 T C 3: 107,756,962 probably null Het
Csmd3 A T 15: 48,004,815 S770T possibly damaging Het
Cul9 C A 17: 46,530,146 V733L probably damaging Het
Cyp2c55 A G 19: 39,031,386 D256G possibly damaging Het
D17Wsu92e T C 17: 27,820,315 D7G probably damaging Het
Dclk3 A T 9: 111,469,185 D599V probably damaging Het
Defb26 T A 2: 152,508,184 I59F possibly damaging Het
Dnah6 A G 6: 73,129,660 V1646A possibly damaging Het
Dnm2 T C 9: 21,504,664 probably null Het
Dock6 A G 9: 21,802,540 L1867P probably damaging Het
Dock9 G T 14: 121,668,459 T93K probably damaging Het
Dync2h1 T C 9: 7,140,995 H1344R probably benign Het
Enam A C 5: 88,504,283 Q1217P possibly damaging Het
Fbf1 A T 11: 116,158,922 D91E possibly damaging Het
Fbxo7 T G 10: 86,046,802 W393G probably damaging Het
Gab2 A G 7: 97,304,213 T599A probably damaging Het
Gfy T A 7: 45,177,188 I409F possibly damaging Het
Gm19345 T A 7: 19,857,508 probably null Het
Gm4787 A G 12: 81,379,213 M57T probably benign Het
Gper1 A G 5: 139,426,725 E275G probably damaging Het
Grik4 T C 9: 42,524,586 E803G probably damaging Het
Gstm3 G A 3: 107,968,197 P39L possibly damaging Het
Hax1 A T 3: 89,997,460 V142D probably damaging Het
Hcn3 A T 3: 89,150,440 I383N probably damaging Het
Hdac10 C A 15: 89,125,397 probably null Het
Hipk3 A C 2: 104,439,329 M505R probably damaging Het
Hivep1 C T 13: 42,159,749 P1822S probably benign Het
Hsd17b13 G T 5: 103,956,258 H281N unknown Het
Irak2 T A 6: 113,672,887 I222N probably damaging Het
Kalrn G A 16: 34,513,926 L7F possibly damaging Het
Kcnma1 A G 14: 23,309,038 probably null Het
Kcnn3 G T 3: 89,520,420 probably benign Het
Lamb1 A C 12: 31,278,776 D218A probably damaging Het
Lrrtm1 A T 6: 77,244,144 N195Y probably damaging Het
Ltf A T 9: 111,022,341 N72I probably damaging Het
Mcm4 A G 16: 15,629,663 I479T probably damaging Het
Mfhas1 T C 8: 35,588,610 S80P probably benign Het
Mknk1 A G 4: 115,878,027 E364G probably damaging Het
Msh4 C T 3: 153,872,283 C458Y probably damaging Het
Mtrr A T 13: 68,564,512 probably null Het
Myo1a T C 10: 127,711,138 W356R probably damaging Het
Nbea A G 3: 55,723,648 V2186A probably benign Het
Nfe2l3 T C 6: 51,451,012 S185P probably damaging Het
Nhsl1 A C 10: 18,531,410 K1397Q probably damaging Het
Nmbr C T 10: 14,770,164 R261W probably damaging Het
Npy2r A G 3: 82,541,058 S137P probably damaging Het
Obscn C T 11: 59,080,205 G2494D probably damaging Het
Obscn T C 11: 59,122,746 K1092E probably damaging Het
Olfr1019 C T 2: 85,841,182 C203Y probably damaging Het
Oosp2 A C 19: 11,649,683 I92S probably benign Het
Pcdh9 T C 14: 93,887,180 D518G probably damaging Het
Pde11a G T 2: 76,337,793 T272K possibly damaging Het
Plekha2 T A 8: 25,059,835 Q162L probably null Het
Prkag2 T A 5: 24,878,734 I84F probably damaging Het
Prm2 G T 16: 10,791,749 probably benign Het
Prpf40a A T 2: 53,142,023 C800S probably damaging Het
Prr5l A T 2: 101,729,448 C158S probably benign Het
Prrt3 C A 6: 113,498,237 C8F possibly damaging Het
Psg25 T C 7: 18,529,803 T32A probably benign Het
Ruvbl1 T C 6: 88,485,905 V337A probably benign Het
Sall1 T A 8: 89,030,341 Q1045L probably damaging Het
Sec22c T C 9: 121,695,642 Y25C probably damaging Het
Serpina3i A T 12: 104,267,777 T335S possibly damaging Het
Setd1b TCCACCACCACCACCACCACCACCA TCCACCACCACCACCACCACCA 5: 123,152,074 probably benign Het
Slc12a8 T A 16: 33,608,159 I279N probably damaging Het
Slc15a1 G A 14: 121,489,907 T83I probably damaging Het
Slc22a3 A G 17: 12,459,771 F222S probably benign Het
Sorcs3 A T 19: 48,693,914 T463S probably benign Het
Spsb4 C A 9: 96,995,878 A131S probably benign Het
Syne2 A G 12: 75,967,710 E3225G probably damaging Het
Tchp G A 5: 114,719,573 probably null Het
Tekt4 T A 17: 25,471,775 D18E probably benign Het
Timm50 A G 7: 28,311,018 V37A probably benign Het
Tlx2 A C 6: 83,068,760 *285G probably null Het
Tmem173 T A 18: 35,738,690 I170F probably damaging Het
Tshz1 C A 18: 84,013,374 D970Y probably damaging Het
Ttn A T 2: 76,870,461 V50E probably damaging Het
Txndc17 T A 11: 72,209,448 S113T probably benign Het
Tyk2 T C 9: 21,108,009 Y1039C probably damaging Het
Ubqln3 A G 7: 104,142,491 S131P probably benign Het
Uncx A T 5: 139,544,082 H30L possibly damaging Het
Usp25 T A 16: 77,115,415 D1007E probably damaging Het
Usp47 T C 7: 112,101,831 V1083A probably damaging Het
Wdr24 T A 17: 25,828,505 H765Q probably damaging Het
Wrnip1 A G 13: 32,802,347 D37G probably damaging Het
Xpo6 T C 7: 126,113,752 T686A possibly damaging Het
Zfp941 G A 7: 140,812,211 R412C probably damaging Het
Znrf2 T A 6: 54,878,440 C71* probably null Het
Other mutations in Cdc42bpa
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00498:Cdc42bpa APN 1 180106121 missense probably damaging 1.00
IGL00807:Cdc42bpa APN 1 180141453 missense possibly damaging 0.88
IGL00972:Cdc42bpa APN 1 180074684 missense probably benign 0.00
IGL01084:Cdc42bpa APN 1 180142274 splice site probably benign
IGL01149:Cdc42bpa APN 1 180074572 missense probably damaging 0.99
IGL01377:Cdc42bpa APN 1 180065143 missense probably damaging 1.00
IGL01541:Cdc42bpa APN 1 180151158 critical splice acceptor site probably null
IGL01657:Cdc42bpa APN 1 180111866 missense probably benign 0.05
IGL01720:Cdc42bpa APN 1 180111282 missense probably damaging 1.00
IGL02227:Cdc42bpa APN 1 180094424 missense possibly damaging 0.64
IGL02234:Cdc42bpa APN 1 180151191 nonsense probably null
IGL02253:Cdc42bpa APN 1 180031596 splice site probably benign
IGL02587:Cdc42bpa APN 1 180093945 missense possibly damaging 0.91
IGL02671:Cdc42bpa APN 1 180061822 missense probably benign
IGL02746:Cdc42bpa APN 1 180111747 missense possibly damaging 0.91
IGL02756:Cdc42bpa APN 1 180109259 missense possibly damaging 0.77
IGL02994:Cdc42bpa APN 1 179999437 missense probably damaging 1.00
IGL03073:Cdc42bpa APN 1 180094376 splice site probably benign
IGL03295:Cdc42bpa APN 1 180150204 missense probably benign 0.00
P0022:Cdc42bpa UTSW 1 179961276 missense probably damaging 0.99
PIT4142001:Cdc42bpa UTSW 1 180031560 missense probably damaging 1.00
R0125:Cdc42bpa UTSW 1 179961198 missense probably damaging 1.00
R0268:Cdc42bpa UTSW 1 180155782 intron probably benign
R0472:Cdc42bpa UTSW 1 180040179 missense probably damaging 1.00
R0492:Cdc42bpa UTSW 1 180101190 missense probably benign 0.00
R0609:Cdc42bpa UTSW 1 180040179 missense probably damaging 1.00
R0691:Cdc42bpa UTSW 1 180144835 missense possibly damaging 0.91
R0738:Cdc42bpa UTSW 1 179999462 splice site probably benign
R1547:Cdc42bpa UTSW 1 180074644 missense probably damaging 0.99
R1553:Cdc42bpa UTSW 1 180093975 missense probably benign 0.01
R1601:Cdc42bpa UTSW 1 180065001 nonsense probably null
R1709:Cdc42bpa UTSW 1 180067224 missense probably damaging 1.00
R2101:Cdc42bpa UTSW 1 180146968 missense probably benign 0.39
R2279:Cdc42bpa UTSW 1 180036919 missense probably damaging 0.99
R2357:Cdc42bpa UTSW 1 180067227 missense possibly damaging 0.81
R2373:Cdc42bpa UTSW 1 180111784 missense possibly damaging 0.78
R2570:Cdc42bpa UTSW 1 180150177 missense possibly damaging 0.84
R3709:Cdc42bpa UTSW 1 180065063 missense probably damaging 1.00
R3710:Cdc42bpa UTSW 1 180065063 missense probably damaging 1.00
R3816:Cdc42bpa UTSW 1 180144886 missense possibly damaging 0.80
R3854:Cdc42bpa UTSW 1 180155978 intron probably benign
R3855:Cdc42bpa UTSW 1 180155978 intron probably benign
R3917:Cdc42bpa UTSW 1 180106154 critical splice donor site probably null
R4622:Cdc42bpa UTSW 1 180074658 missense probably damaging 0.98
R4664:Cdc42bpa UTSW 1 180144565 missense probably damaging 0.99
R4665:Cdc42bpa UTSW 1 180144565 missense probably damaging 0.99
R4887:Cdc42bpa UTSW 1 180144635 missense possibly damaging 0.61
R4989:Cdc42bpa UTSW 1 180137801 missense probably damaging 0.99
R5033:Cdc42bpa UTSW 1 180065015 missense probably damaging 1.00
R5050:Cdc42bpa UTSW 1 180072453 nonsense probably null
R5077:Cdc42bpa UTSW 1 180094533 intron probably benign
R5196:Cdc42bpa UTSW 1 180072413 missense probably benign 0.09
R5276:Cdc42bpa UTSW 1 180137850 missense probably damaging 1.00
R5313:Cdc42bpa UTSW 1 180084433 missense probably benign
R5364:Cdc42bpa UTSW 1 180067182 missense probably benign 0.06
R5372:Cdc42bpa UTSW 1 180064979 missense probably damaging 1.00
R5405:Cdc42bpa UTSW 1 180067329 missense probably damaging 1.00
R5405:Cdc42bpa UTSW 1 180138520 missense possibly damaging 0.95
R5646:Cdc42bpa UTSW 1 180106094 missense probably damaging 0.99
R5713:Cdc42bpa UTSW 1 180084410 missense probably benign 0.03
R6012:Cdc42bpa UTSW 1 180065090 missense probably damaging 1.00
R6029:Cdc42bpa UTSW 1 180111787 missense probably damaging 1.00
R6378:Cdc42bpa UTSW 1 180093996 missense possibly damaging 0.91
R6609:Cdc42bpa UTSW 1 180101274 critical splice donor site probably null
R7122:Cdc42bpa UTSW 1 180065018 missense probably damaging 1.00
R7289:Cdc42bpa UTSW 1 180061797 nonsense probably null
R7670:Cdc42bpa UTSW 1 180065081 missense probably damaging 1.00
R7912:Cdc42bpa UTSW 1 180094013 missense probably damaging 1.00
R8139:Cdc42bpa UTSW 1 180069319 missense probably damaging 1.00
R8362:Cdc42bpa UTSW 1 180162125 missense probably damaging 0.98
R8378:Cdc42bpa UTSW 1 180162144 missense probably damaging 0.98
R8794:Cdc42bpa UTSW 1 180067251 missense probably damaging 1.00
R8835:Cdc42bpa UTSW 1 180069351 missense probably damaging 1.00
R8896:Cdc42bpa UTSW 1 180130808 intron probably benign
X0026:Cdc42bpa UTSW 1 179961198 missense probably damaging 1.00
Z1176:Cdc42bpa UTSW 1 180065093 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCATAATGGGCTTGGCAAAAG -3'
(R):5'- AAGACACCAAGGTTGTCAGG -3'

Sequencing Primer
(F):5'- AAATTCTCCAGTGCGGCC -3'
(R):5'- CCAAGGTTGTCAGGAACTCAGTC -3'
Posted On2015-09-25