Incidental Mutation 'R4604:Hipk3'
ID 345844
Institutional Source Beutler Lab
Gene Symbol Hipk3
Ensembl Gene ENSMUSG00000027177
Gene Name homeodomain interacting protein kinase 3
Synonyms DYRK6, FIST3
MMRRC Submission 041816-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R4604 (G1)
Quality Score 225
Status Not validated
Chromosome 2
Chromosomal Location 104256826-104324791 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to C at 104269674 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Methionine to Arginine at position 505 (M505R)
Ref Sequence ENSEMBL: ENSMUSP00000106754 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028600] [ENSMUST00000111124] [ENSMUST00000111125]
AlphaFold Q9ERH7
Predicted Effect probably damaging
Transcript: ENSMUST00000028600
AA Change: M505R

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000028600
Gene: ENSMUSG00000027177
AA Change: M505R

DomainStartEndE-ValueType
S_TKc 197 525 1.58e-76 SMART
low complexity region 844 859 N/A INTRINSIC
low complexity region 887 906 N/A INTRINSIC
low complexity region 1093 1117 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000111124
AA Change: M505R

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000106753
Gene: ENSMUSG00000027177
AA Change: M505R

DomainStartEndE-ValueType
S_TKc 197 525 1.58e-76 SMART
low complexity region 844 859 N/A INTRINSIC
low complexity region 887 906 N/A INTRINSIC
low complexity region 1093 1117 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000111125
AA Change: M505R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000106754
Gene: ENSMUSG00000027177
AA Change: M505R

DomainStartEndE-ValueType
S_TKc 197 525 1.58e-76 SMART
low complexity region 865 880 N/A INTRINSIC
low complexity region 908 927 N/A INTRINSIC
low complexity region 1114 1138 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132622
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a gene trapped allele exhibit impaired insulin secretion and glucose tolerance. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 106 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930518I15Rik C T 2: 156,699,074 (GRCm39) probably benign Het
Abcb6 G A 1: 75,156,521 (GRCm39) T81I probably benign Het
Acp6 A G 3: 97,083,075 (GRCm39) K362R probably benign Het
Adam26a A G 8: 44,023,088 (GRCm39) M134T probably benign Het
Ankrd27 C T 7: 35,327,915 (GRCm39) P812S probably damaging Het
Arl6ip1 AAAATAAATAAATAAATAAATAAATA AAAATAAATAAATAAATAAATAAATAAATA 7: 117,721,122 (GRCm39) probably benign Het
Atp2a1 G A 7: 126,047,795 (GRCm39) R672C probably damaging Het
Atxn2 G T 5: 121,919,406 (GRCm39) W371C probably damaging Het
B3gnt2 T TTCACAAA 11: 22,786,426 (GRCm39) probably null Het
Btnl6 T A 17: 34,727,435 (GRCm39) D365V possibly damaging Het
Ccdc80 T A 16: 44,915,928 (GRCm39) L228Q probably damaging Het
Cdc42bpa A G 1: 179,936,759 (GRCm39) H718R probably benign Het
Cdh18 A G 15: 23,474,454 (GRCm39) K775E probably benign Het
Cdh23 T G 10: 60,173,445 (GRCm39) N1679T possibly damaging Het
Cep192 T A 18: 67,948,993 (GRCm39) D271E possibly damaging Het
Cfap70 G T 14: 20,493,729 (GRCm39) T124K probably benign Het
Ckap5 A T 2: 91,408,476 (GRCm39) E890D probably benign Het
Col22a1 G T 15: 71,824,188 (GRCm39) P569T probably benign Het
Colq A T 14: 31,267,060 (GRCm39) L150Q possibly damaging Het
Csf1 T C 3: 107,664,278 (GRCm39) probably null Het
Csmd3 A T 15: 47,868,211 (GRCm39) S770T possibly damaging Het
Cul9 C A 17: 46,841,072 (GRCm39) V733L probably damaging Het
Cyp2c55 A G 19: 39,019,830 (GRCm39) D256G possibly damaging Het
Dclk3 A T 9: 111,298,253 (GRCm39) D599V probably damaging Het
Defb26 T A 2: 152,350,104 (GRCm39) I59F possibly damaging Het
Dnah6 A G 6: 73,106,643 (GRCm39) V1646A possibly damaging Het
Dnm2 T C 9: 21,415,960 (GRCm39) probably null Het
Dock6 A G 9: 21,713,836 (GRCm39) L1867P probably damaging Het
Dock9 G T 14: 121,905,871 (GRCm39) T93K probably damaging Het
Dync2h1 T C 9: 7,140,995 (GRCm39) H1344R probably benign Het
Enam A C 5: 88,652,142 (GRCm39) Q1217P possibly damaging Het
Fbf1 A T 11: 116,049,748 (GRCm39) D91E possibly damaging Het
Fbxo7 T G 10: 85,882,666 (GRCm39) W393G probably damaging Het
Gab2 A G 7: 96,953,420 (GRCm39) T599A probably damaging Het
Gfy T A 7: 44,826,612 (GRCm39) I409F possibly damaging Het
Gm19345 T A 7: 19,591,433 (GRCm39) probably null Het
Gm4787 A G 12: 81,425,987 (GRCm39) M57T probably benign Het
Gper1 A G 5: 139,412,480 (GRCm39) E275G probably damaging Het
Grik4 T C 9: 42,435,882 (GRCm39) E803G probably damaging Het
Gstm3 G A 3: 107,875,513 (GRCm39) P39L possibly damaging Het
Hax1 A T 3: 89,904,767 (GRCm39) V142D probably damaging Het
Hcn3 A T 3: 89,057,747 (GRCm39) I383N probably damaging Het
Hdac10 C A 15: 89,009,600 (GRCm39) probably null Het
Hivep1 C T 13: 42,313,225 (GRCm39) P1822S probably benign Het
Hsd17b13 G T 5: 104,104,124 (GRCm39) H281N unknown Het
Ilrun T C 17: 28,039,289 (GRCm39) D7G probably damaging Het
Irak2 T A 6: 113,649,848 (GRCm39) I222N probably damaging Het
Kalrn G A 16: 34,334,296 (GRCm39) L7F possibly damaging Het
Kcnma1 A G 14: 23,359,106 (GRCm39) probably null Het
Kcnn3 G T 3: 89,427,727 (GRCm39) probably benign Het
Lamb1 A C 12: 31,328,775 (GRCm39) D218A probably damaging Het
Lrrtm1 A T 6: 77,221,127 (GRCm39) N195Y probably damaging Het
Ltf A T 9: 110,851,409 (GRCm39) N72I probably damaging Het
Mcm4 A G 16: 15,447,527 (GRCm39) I479T probably damaging Het
Mfhas1 T C 8: 36,055,764 (GRCm39) S80P probably benign Het
Mknk1 A G 4: 115,735,224 (GRCm39) E364G probably damaging Het
Msh4 C T 3: 153,577,920 (GRCm39) C458Y probably damaging Het
Mtrr A T 13: 68,712,631 (GRCm39) probably null Het
Myo1a T C 10: 127,547,007 (GRCm39) W356R probably damaging Het
Nbea A G 3: 55,631,069 (GRCm39) V2186A probably benign Het
Nfe2l3 T C 6: 51,427,992 (GRCm39) S185P probably damaging Het
Nhsl1 A C 10: 18,407,158 (GRCm39) K1397Q probably damaging Het
Nmbr C T 10: 14,645,908 (GRCm39) R261W probably damaging Het
Npy2r A G 3: 82,448,365 (GRCm39) S137P probably damaging Het
Obscn C T 11: 58,971,031 (GRCm39) G2494D probably damaging Het
Obscn T C 11: 59,013,572 (GRCm39) K1092E probably damaging Het
Oosp2 A C 19: 11,627,047 (GRCm39) I92S probably benign Het
Or5ar1 C T 2: 85,671,526 (GRCm39) C203Y probably damaging Het
Pcdh9 T C 14: 94,124,616 (GRCm39) D518G probably damaging Het
Pde11a G T 2: 76,168,137 (GRCm39) T272K possibly damaging Het
Plekha2 T A 8: 25,549,851 (GRCm39) Q162L probably null Het
Prkag2 T A 5: 25,083,732 (GRCm39) I84F probably damaging Het
Prm2 G T 16: 10,609,613 (GRCm39) probably benign Het
Prpf40a A T 2: 53,032,035 (GRCm39) C800S probably damaging Het
Prr5l A T 2: 101,559,793 (GRCm39) C158S probably benign Het
Prrt3 C A 6: 113,475,198 (GRCm39) C8F possibly damaging Het
Psg25 T C 7: 18,263,728 (GRCm39) T32A probably benign Het
Ruvbl1 T C 6: 88,462,887 (GRCm39) V337A probably benign Het
Sall1 T A 8: 89,756,969 (GRCm39) Q1045L probably damaging Het
Sec22c T C 9: 121,524,708 (GRCm39) Y25C probably damaging Het
Serpina3i A T 12: 104,234,036 (GRCm39) T335S possibly damaging Het
Setd1b TCCACCACCACCACCACCACCACCA TCCACCACCACCACCACCACCA 5: 123,290,137 (GRCm39) probably benign Het
Slc12a8 T A 16: 33,428,529 (GRCm39) I279N probably damaging Het
Slc15a1 G A 14: 121,727,319 (GRCm39) T83I probably damaging Het
Slc22a3 A G 17: 12,678,658 (GRCm39) F222S probably benign Het
Sorcs3 A T 19: 48,682,353 (GRCm39) T463S probably benign Het
Spsb4 C A 9: 96,877,931 (GRCm39) A131S probably benign Het
Sting1 T A 18: 35,871,743 (GRCm39) I170F probably damaging Het
Syne2 A G 12: 76,014,484 (GRCm39) E3225G probably damaging Het
Tchp G A 5: 114,857,634 (GRCm39) probably null Het
Tekt4 T A 17: 25,690,749 (GRCm39) D18E probably benign Het
Timm50 A G 7: 28,010,443 (GRCm39) V37A probably benign Het
Tlx2 A C 6: 83,045,741 (GRCm39) *285G probably null Het
Tshz1 C A 18: 84,031,499 (GRCm39) D970Y probably damaging Het
Ttn A T 2: 76,700,805 (GRCm39) V50E probably damaging Het
Txndc17 T A 11: 72,100,274 (GRCm39) S113T probably benign Het
Tyk2 T C 9: 21,019,305 (GRCm39) Y1039C probably damaging Het
Ubqln3 A G 7: 103,791,698 (GRCm39) S131P probably benign Het
Uncx A T 5: 139,529,837 (GRCm39) H30L possibly damaging Het
Usp25 T A 16: 76,912,303 (GRCm39) D1007E probably damaging Het
Usp47 T C 7: 111,701,038 (GRCm39) V1083A probably damaging Het
Wdr24 T A 17: 26,047,479 (GRCm39) H765Q probably damaging Het
Wrnip1 A G 13: 32,986,330 (GRCm39) D37G probably damaging Het
Xpo6 T C 7: 125,712,924 (GRCm39) T686A possibly damaging Het
Zfp941 G A 7: 140,392,124 (GRCm39) R412C probably damaging Het
Znrf2 T A 6: 54,855,425 (GRCm39) C71* probably null Het
Other mutations in Hipk3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00717:Hipk3 APN 2 104,260,576 (GRCm39) missense possibly damaging 0.52
IGL00937:Hipk3 APN 2 104,263,517 (GRCm39) missense possibly damaging 0.82
IGL01719:Hipk3 APN 2 104,267,434 (GRCm39) missense possibly damaging 0.78
IGL01802:Hipk3 APN 2 104,302,198 (GRCm39) splice site probably benign
IGL01932:Hipk3 APN 2 104,301,326 (GRCm39) missense probably damaging 1.00
IGL02089:Hipk3 APN 2 104,261,724 (GRCm39) missense probably damaging 1.00
IGL02522:Hipk3 APN 2 104,301,676 (GRCm39) missense probably damaging 1.00
IGL02525:Hipk3 APN 2 104,301,757 (GRCm39) missense probably damaging 1.00
IGL02959:Hipk3 APN 2 104,301,604 (GRCm39) missense probably damaging 1.00
IGL02986:Hipk3 APN 2 104,264,086 (GRCm39) missense probably damaging 1.00
R0136:Hipk3 UTSW 2 104,269,638 (GRCm39) missense probably benign 0.02
R0277:Hipk3 UTSW 2 104,271,593 (GRCm39) missense probably damaging 1.00
R0308:Hipk3 UTSW 2 104,263,552 (GRCm39) missense probably damaging 0.99
R0367:Hipk3 UTSW 2 104,261,594 (GRCm39) nonsense probably null
R0597:Hipk3 UTSW 2 104,263,982 (GRCm39) missense possibly damaging 0.94
R1079:Hipk3 UTSW 2 104,302,043 (GRCm39) missense probably benign 0.00
R1171:Hipk3 UTSW 2 104,302,021 (GRCm39) missense probably benign 0.02
R1244:Hipk3 UTSW 2 104,263,601 (GRCm39) missense probably damaging 1.00
R1509:Hipk3 UTSW 2 104,271,607 (GRCm39) missense probably benign 0.01
R1616:Hipk3 UTSW 2 104,264,090 (GRCm39) nonsense probably null
R1893:Hipk3 UTSW 2 104,263,601 (GRCm39) missense probably damaging 1.00
R1938:Hipk3 UTSW 2 104,260,533 (GRCm39) missense possibly damaging 0.89
R1969:Hipk3 UTSW 2 104,264,186 (GRCm39) missense probably damaging 1.00
R1975:Hipk3 UTSW 2 104,301,518 (GRCm39) missense probably benign 0.00
R1985:Hipk3 UTSW 2 104,264,780 (GRCm39) missense probably benign 0.16
R2105:Hipk3 UTSW 2 104,269,737 (GRCm39) missense probably damaging 0.97
R2422:Hipk3 UTSW 2 104,301,830 (GRCm39) missense probably benign 0.01
R3028:Hipk3 UTSW 2 104,264,135 (GRCm39) missense probably benign
R3747:Hipk3 UTSW 2 104,271,628 (GRCm39) nonsense probably null
R3923:Hipk3 UTSW 2 104,301,107 (GRCm39) missense probably damaging 1.00
R4320:Hipk3 UTSW 2 104,276,916 (GRCm39) missense probably damaging 1.00
R4321:Hipk3 UTSW 2 104,276,916 (GRCm39) missense probably damaging 1.00
R4322:Hipk3 UTSW 2 104,276,916 (GRCm39) missense probably damaging 1.00
R4323:Hipk3 UTSW 2 104,276,916 (GRCm39) missense probably damaging 1.00
R4324:Hipk3 UTSW 2 104,276,916 (GRCm39) missense probably damaging 1.00
R4595:Hipk3 UTSW 2 104,271,622 (GRCm39) missense probably benign 0.01
R4657:Hipk3 UTSW 2 104,264,104 (GRCm39) missense probably benign 0.00
R5193:Hipk3 UTSW 2 104,260,345 (GRCm39) missense possibly damaging 0.94
R5769:Hipk3 UTSW 2 104,265,298 (GRCm39) missense possibly damaging 0.69
R5843:Hipk3 UTSW 2 104,270,569 (GRCm39) missense possibly damaging 0.65
R5906:Hipk3 UTSW 2 104,302,153 (GRCm39) missense probably damaging 1.00
R5976:Hipk3 UTSW 2 104,301,529 (GRCm39) missense probably damaging 1.00
R5991:Hipk3 UTSW 2 104,268,328 (GRCm39) missense probably damaging 1.00
R6214:Hipk3 UTSW 2 104,264,086 (GRCm39) missense probably damaging 1.00
R6215:Hipk3 UTSW 2 104,264,086 (GRCm39) missense probably damaging 1.00
R6285:Hipk3 UTSW 2 104,301,770 (GRCm39) missense probably damaging 1.00
R6523:Hipk3 UTSW 2 104,269,753 (GRCm39) missense possibly damaging 0.50
R6713:Hipk3 UTSW 2 104,276,916 (GRCm39) missense probably damaging 1.00
R7381:Hipk3 UTSW 2 104,269,696 (GRCm39) missense probably damaging 0.99
R7517:Hipk3 UTSW 2 104,265,059 (GRCm39) missense probably benign 0.00
R8780:Hipk3 UTSW 2 104,264,179 (GRCm39) missense probably damaging 0.99
R8843:Hipk3 UTSW 2 104,268,242 (GRCm39) missense probably benign 0.21
R9186:Hipk3 UTSW 2 104,301,439 (GRCm39) missense probably damaging 1.00
R9187:Hipk3 UTSW 2 104,276,936 (GRCm39) missense probably damaging 1.00
R9374:Hipk3 UTSW 2 104,301,850 (GRCm39) missense probably benign
R9398:Hipk3 UTSW 2 104,263,562 (GRCm39) missense probably benign 0.01
R9552:Hipk3 UTSW 2 104,301,850 (GRCm39) missense probably benign
R9584:Hipk3 UTSW 2 104,301,910 (GRCm39) missense probably benign 0.01
R9641:Hipk3 UTSW 2 104,267,376 (GRCm39) missense probably benign
X0021:Hipk3 UTSW 2 104,271,711 (GRCm39) critical splice acceptor site probably null
Z1088:Hipk3 UTSW 2 104,264,974 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGACACTTGGGAGTCAGGAG -3'
(R):5'- CAAATGGCTGTAGTTCACTGTTTTG -3'

Sequencing Primer
(F):5'- TCAGCCAAGTTAGCTCAGTC -3'
(R):5'- GATGGCTTCAAACTTTGCT -3'
Posted On 2015-09-25