Incidental Mutation 'R4604:Pcdh9'
ID345925
Institutional Source Beutler Lab
Gene Symbol Pcdh9
Ensembl Gene ENSMUSG00000055421
Gene Nameprotocadherin 9
SynonymsC630029H24Rik, A730003J17Rik, C530050I23Rik, LOC382930, 1500001L12Rik
MMRRC Submission 041816-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.250) question?
Stock #R4604 (G1)
Quality Score225
Status Not validated
Chromosome14
Chromosomal Location93013410-93890679 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 93887180 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 518 (D518G)
Ref Sequence ENSEMBL: ENSMUSP00000142224 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000068992] [ENSMUST00000192221] [ENSMUST00000193901] [ENSMUST00000194056] [ENSMUST00000195376] [ENSMUST00000195826]
Predicted Effect probably damaging
Transcript: ENSMUST00000068992
AA Change: D518G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000070935
Gene: ENSMUSG00000055421
AA Change: D518G

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
CA 49 140 8.37e-3 SMART
CA 164 250 1.01e-20 SMART
CA 274 356 2.34e-25 SMART
CA 386 467 2.14e-19 SMART
CA 491 570 4.27e-28 SMART
CA 594 673 2.45e-28 SMART
CA 700 782 1.01e-6 SMART
transmembrane domain 814 836 N/A INTRINSIC
low complexity region 858 883 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000192221
AA Change: D395G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000142260
Gene: ENSMUSG00000055421
AA Change: D395G

DomainStartEndE-ValueType
CA 41 127 1.01e-20 SMART
CA 151 233 2.34e-25 SMART
CA 263 344 2.14e-19 SMART
CA 368 447 4.27e-28 SMART
CA 471 550 2.45e-28 SMART
CA 577 659 1.01e-6 SMART
transmembrane domain 691 713 N/A INTRINSIC
low complexity region 735 760 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000192817
Predicted Effect probably damaging
Transcript: ENSMUST00000193901
AA Change: D518G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000141759
Gene: ENSMUSG00000055421
AA Change: D518G

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
CA 49 140 8.37e-3 SMART
CA 164 250 1.01e-20 SMART
CA 274 356 2.34e-25 SMART
CA 386 467 2.14e-19 SMART
CA 491 570 4.27e-28 SMART
CA 594 673 2.45e-28 SMART
CA 700 782 1.01e-6 SMART
transmembrane domain 814 836 N/A INTRINSIC
low complexity region 858 883 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000194056
AA Change: D518G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000141602
Gene: ENSMUSG00000055421
AA Change: D518G

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
CA 49 140 4.1e-5 SMART
CA 164 250 4.8e-23 SMART
CA 274 356 1.2e-27 SMART
CA 386 467 1.1e-21 SMART
CA 491 570 2e-30 SMART
CA 594 673 1.2e-30 SMART
CA 700 782 4.9e-9 SMART
transmembrane domain 814 836 N/A INTRINSIC
low complexity region 860 873 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000194129
Predicted Effect probably damaging
Transcript: ENSMUST00000195376
AA Change: D518G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000142224
Gene: ENSMUSG00000055421
AA Change: D518G

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
CA 49 140 4.1e-5 SMART
CA 164 250 4.8e-23 SMART
CA 274 356 1.2e-27 SMART
CA 386 467 1.1e-21 SMART
CA 491 570 2e-30 SMART
CA 594 673 1.2e-30 SMART
CA 700 782 4.9e-9 SMART
transmembrane domain 814 836 N/A INTRINSIC
low complexity region 858 883 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000195826
AA Change: D518G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000141396
Gene: ENSMUSG00000055421
AA Change: D518G

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
CA 49 140 8.37e-3 SMART
CA 164 250 1.01e-20 SMART
CA 274 356 2.34e-25 SMART
CA 386 467 2.14e-19 SMART
CA 491 570 4.27e-28 SMART
CA 594 673 2.45e-28 SMART
CA 700 782 1.01e-6 SMART
transmembrane domain 814 836 N/A INTRINSIC
low complexity region 858 883 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the protocadherin family, and cadherin superfamily, of transmembrane proteins containing cadherin domains. These proteins mediate cell adhesion in neural tissues in the presence of calcium. The encoded protein may be involved in signaling at neuronal synaptic junctions. Sharing a characteristic with other protocadherin genes, this gene has a notably large exon that encodes multiple cadherin domains and a transmembrane region. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Nov 2012]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit impaired long-term social and bject recognition and sensorimotor development. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 106 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930518I15Rik C T 2: 156,857,154 probably benign Het
Abcb6 G A 1: 75,179,877 T81I probably benign Het
Acp6 A G 3: 97,175,759 K362R probably benign Het
Adam26a A G 8: 43,570,051 M134T probably benign Het
Ankrd27 C T 7: 35,628,490 P812S probably damaging Het
Arl6ip1 AAAATAAATAAATAAATAAATAAATA AAAATAAATAAATAAATAAATAAATAAATA 7: 118,121,899 probably benign Het
Atp2a1 G A 7: 126,448,623 R672C probably damaging Het
Atxn2 G T 5: 121,781,343 W371C probably damaging Het
B3gnt2 T TTCACAAA 11: 22,836,426 probably null Het
Btnl6 T A 17: 34,508,461 D365V possibly damaging Het
Ccdc80 T A 16: 45,095,565 L228Q probably damaging Het
Cdc42bpa A G 1: 180,109,194 H718R probably benign Het
Cdh18 A G 15: 23,474,368 K775E probably benign Het
Cdh23 T G 10: 60,337,666 N1679T possibly damaging Het
Cep192 T A 18: 67,815,922 D271E possibly damaging Het
Cfap70 G T 14: 20,443,661 T124K probably benign Het
Ckap5 A T 2: 91,578,131 E890D probably benign Het
Col22a1 G T 15: 71,952,339 P569T probably benign Het
Colq A T 14: 31,545,103 L150Q possibly damaging Het
Csf1 T C 3: 107,756,962 probably null Het
Csmd3 A T 15: 48,004,815 S770T possibly damaging Het
Cul9 C A 17: 46,530,146 V733L probably damaging Het
Cyp2c55 A G 19: 39,031,386 D256G possibly damaging Het
D17Wsu92e T C 17: 27,820,315 D7G probably damaging Het
Dclk3 A T 9: 111,469,185 D599V probably damaging Het
Defb26 T A 2: 152,508,184 I59F possibly damaging Het
Dnah6 A G 6: 73,129,660 V1646A possibly damaging Het
Dnm2 T C 9: 21,504,664 probably null Het
Dock6 A G 9: 21,802,540 L1867P probably damaging Het
Dock9 G T 14: 121,668,459 T93K probably damaging Het
Dync2h1 T C 9: 7,140,995 H1344R probably benign Het
Enam A C 5: 88,504,283 Q1217P possibly damaging Het
Fbf1 A T 11: 116,158,922 D91E possibly damaging Het
Fbxo7 T G 10: 86,046,802 W393G probably damaging Het
Gab2 A G 7: 97,304,213 T599A probably damaging Het
Gfy T A 7: 45,177,188 I409F possibly damaging Het
Gm19345 T A 7: 19,857,508 probably null Het
Gm4787 A G 12: 81,379,213 M57T probably benign Het
Gper1 A G 5: 139,426,725 E275G probably damaging Het
Grik4 T C 9: 42,524,586 E803G probably damaging Het
Gstm3 G A 3: 107,968,197 P39L possibly damaging Het
Hax1 A T 3: 89,997,460 V142D probably damaging Het
Hcn3 A T 3: 89,150,440 I383N probably damaging Het
Hdac10 C A 15: 89,125,397 probably null Het
Hipk3 A C 2: 104,439,329 M505R probably damaging Het
Hivep1 C T 13: 42,159,749 P1822S probably benign Het
Hsd17b13 G T 5: 103,956,258 H281N unknown Het
Irak2 T A 6: 113,672,887 I222N probably damaging Het
Kalrn G A 16: 34,513,926 L7F possibly damaging Het
Kcnma1 A G 14: 23,309,038 probably null Het
Kcnn3 G T 3: 89,520,420 probably benign Het
Lamb1 A C 12: 31,278,776 D218A probably damaging Het
Lrrtm1 A T 6: 77,244,144 N195Y probably damaging Het
Ltf A T 9: 111,022,341 N72I probably damaging Het
Mcm4 A G 16: 15,629,663 I479T probably damaging Het
Mfhas1 T C 8: 35,588,610 S80P probably benign Het
Mknk1 A G 4: 115,878,027 E364G probably damaging Het
Msh4 C T 3: 153,872,283 C458Y probably damaging Het
Mtrr A T 13: 68,564,512 probably null Het
Myo1a T C 10: 127,711,138 W356R probably damaging Het
Nbea A G 3: 55,723,648 V2186A probably benign Het
Nfe2l3 T C 6: 51,451,012 S185P probably damaging Het
Nhsl1 A C 10: 18,531,410 K1397Q probably damaging Het
Nmbr C T 10: 14,770,164 R261W probably damaging Het
Npy2r A G 3: 82,541,058 S137P probably damaging Het
Obscn C T 11: 59,080,205 G2494D probably damaging Het
Obscn T C 11: 59,122,746 K1092E probably damaging Het
Olfr1019 C T 2: 85,841,182 C203Y probably damaging Het
Oosp2 A C 19: 11,649,683 I92S probably benign Het
Pde11a G T 2: 76,337,793 T272K possibly damaging Het
Plekha2 T A 8: 25,059,835 Q162L probably null Het
Prkag2 T A 5: 24,878,734 I84F probably damaging Het
Prm2 G T 16: 10,791,749 probably benign Het
Prpf40a A T 2: 53,142,023 C800S probably damaging Het
Prr5l A T 2: 101,729,448 C158S probably benign Het
Prrt3 C A 6: 113,498,237 C8F possibly damaging Het
Psg25 T C 7: 18,529,803 T32A probably benign Het
Ruvbl1 T C 6: 88,485,905 V337A probably benign Het
Sall1 T A 8: 89,030,341 Q1045L probably damaging Het
Sec22c T C 9: 121,695,642 Y25C probably damaging Het
Serpina3i A T 12: 104,267,777 T335S possibly damaging Het
Setd1b TCCACCACCACCACCACCACCACCA TCCACCACCACCACCACCACCA 5: 123,152,074 probably benign Het
Slc12a8 T A 16: 33,608,159 I279N probably damaging Het
Slc15a1 G A 14: 121,489,907 T83I probably damaging Het
Slc22a3 A G 17: 12,459,771 F222S probably benign Het
Sorcs3 A T 19: 48,693,914 T463S probably benign Het
Spsb4 C A 9: 96,995,878 A131S probably benign Het
Syne2 A G 12: 75,967,710 E3225G probably damaging Het
Tchp G A 5: 114,719,573 probably null Het
Tekt4 T A 17: 25,471,775 D18E probably benign Het
Timm50 A G 7: 28,311,018 V37A probably benign Het
Tlx2 A C 6: 83,068,760 *285G probably null Het
Tmem173 T A 18: 35,738,690 I170F probably damaging Het
Tshz1 C A 18: 84,013,374 D970Y probably damaging Het
Ttn A T 2: 76,870,461 V50E probably damaging Het
Txndc17 T A 11: 72,209,448 S113T probably benign Het
Tyk2 T C 9: 21,108,009 Y1039C probably damaging Het
Ubqln3 A G 7: 104,142,491 S131P probably benign Het
Uncx A T 5: 139,544,082 H30L possibly damaging Het
Usp25 T A 16: 77,115,415 D1007E probably damaging Het
Usp47 T C 7: 112,101,831 V1083A probably damaging Het
Wdr24 T A 17: 25,828,505 H765Q probably damaging Het
Wrnip1 A G 13: 32,802,347 D37G probably damaging Het
Xpo6 T C 7: 126,113,752 T686A possibly damaging Het
Zfp941 G A 7: 140,812,211 R412C probably damaging Het
Znrf2 T A 6: 54,878,440 C71* probably null Het
Other mutations in Pcdh9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00482:Pcdh9 APN 14 93326694 missense probably damaging 1.00
IGL02183:Pcdh9 APN 14 93886284 missense probably benign 0.01
IGL02244:Pcdh9 APN 14 93326768 missense probably damaging 1.00
IGL02571:Pcdh9 APN 14 93560587 splice site probably benign
IGL03018:Pcdh9 APN 14 93015576 missense probably null
I1329:Pcdh9 UTSW 14 93886209 missense probably benign 0.00
R0027:Pcdh9 UTSW 14 93888645 missense probably null 0.99
R0027:Pcdh9 UTSW 14 93888645 missense probably null 0.99
R0477:Pcdh9 UTSW 14 93887678 missense probably damaging 0.99
R0499:Pcdh9 UTSW 14 93886235 missense probably damaging 1.00
R0787:Pcdh9 UTSW 14 93886757 missense possibly damaging 0.88
R1205:Pcdh9 UTSW 14 93886065 missense probably benign 0.01
R1616:Pcdh9 UTSW 14 93886969 nonsense probably null
R1620:Pcdh9 UTSW 14 93888305 missense probably damaging 1.00
R1622:Pcdh9 UTSW 14 93885875 missense probably benign 0.03
R1708:Pcdh9 UTSW 14 93888305 missense probably damaging 1.00
R1721:Pcdh9 UTSW 14 93888035 missense probably damaging 1.00
R1753:Pcdh9 UTSW 14 93887225 missense probably benign 0.33
R1799:Pcdh9 UTSW 14 93888671 missense probably benign 0.36
R1867:Pcdh9 UTSW 14 93888035 missense probably damaging 1.00
R1987:Pcdh9 UTSW 14 93888305 missense probably damaging 1.00
R1988:Pcdh9 UTSW 14 93888305 missense probably damaging 1.00
R2444:Pcdh9 UTSW 14 93886791 missense probably benign 0.10
R3895:Pcdh9 UTSW 14 93887538 missense probably damaging 1.00
R3926:Pcdh9 UTSW 14 93886810 nonsense probably null
R4166:Pcdh9 UTSW 14 93887520 nonsense probably null
R4429:Pcdh9 UTSW 14 93887384 missense probably damaging 0.96
R4589:Pcdh9 UTSW 14 93888192 missense probably damaging 1.00
R4607:Pcdh9 UTSW 14 93015573 missense probably benign 0.08
R4621:Pcdh9 UTSW 14 93887643 missense probably benign 0.12
R4624:Pcdh9 UTSW 14 93886409 missense probably damaging 1.00
R4712:Pcdh9 UTSW 14 93888631 missense probably damaging 1.00
R4788:Pcdh9 UTSW 14 93887415 missense probably damaging 1.00
R4831:Pcdh9 UTSW 14 93887941 missense probably damaging 1.00
R4883:Pcdh9 UTSW 14 93888728 missense possibly damaging 0.83
R5034:Pcdh9 UTSW 14 93326849 missense probably benign 0.13
R5175:Pcdh9 UTSW 14 93888443 missense probably damaging 1.00
R5637:Pcdh9 UTSW 14 93885762 missense possibly damaging 0.91
R5743:Pcdh9 UTSW 14 93886724 missense probably damaging 1.00
R5753:Pcdh9 UTSW 14 93888161 missense probably damaging 1.00
R5770:Pcdh9 UTSW 14 93886943 missense probably damaging 1.00
R5900:Pcdh9 UTSW 14 93326720 missense probably damaging 0.98
R5986:Pcdh9 UTSW 14 93887048 missense probably damaging 1.00
R6052:Pcdh9 UTSW 14 93885846 missense probably benign 0.40
R6113:Pcdh9 UTSW 14 93887108 missense probably damaging 1.00
R6223:Pcdh9 UTSW 14 93015733 missense probably benign 0.18
R6415:Pcdh9 UTSW 14 93015842 missense possibly damaging 0.83
R6435:Pcdh9 UTSW 14 93887844 missense probably benign 0.01
R7064:Pcdh9 UTSW 14 93886149 missense probably damaging 1.00
R7143:Pcdh9 UTSW 14 93888272 missense probably damaging 0.99
R7219:Pcdh9 UTSW 14 93015780 missense possibly damaging 0.87
R7262:Pcdh9 UTSW 14 93015705 missense probably benign 0.01
R7354:Pcdh9 UTSW 14 93888270 missense probably benign 0.28
R7369:Pcdh9 UTSW 14 93886367 missense possibly damaging 0.67
R7427:Pcdh9 UTSW 14 93887111 missense probably damaging 1.00
R7428:Pcdh9 UTSW 14 93887111 missense probably damaging 1.00
X0012:Pcdh9 UTSW 14 93886644 missense possibly damaging 0.71
X0067:Pcdh9 UTSW 14 93326849 missense probably benign 0.13
Predicted Primers PCR Primer
(F):5'- ACTTTGGCAGATTCTCAGACAC -3'
(R):5'- CTGGTAAGGGTTAAGCTCGAG -3'

Sequencing Primer
(F):5'- TATCACTGCTGCTTGGCT -3'
(R):5'- GCTCGAGGATGAAAATGACAACCC -3'
Posted On2015-09-25