Incidental Mutation 'R4604:Col22a1'
ID345929
Institutional Source Beutler Lab
Gene Symbol Col22a1
Ensembl Gene ENSMUSG00000079022
Gene Namecollagen, type XXII, alpha 1
SynonymsC80743, 2310067L16Rik
MMRRC Submission 041816-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4604 (G1)
Quality Score225
Status Not validated
Chromosome15
Chromosomal Location71795795-72034227 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 71952339 bp
ZygosityHeterozygous
Amino Acid Change Proline to Threonine at position 569 (P569T)
Ref Sequence ENSEMBL: ENSMUSP00000125069 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000159410] [ENSMUST00000159993] [ENSMUST00000229585]
Predicted Effect probably benign
Transcript: ENSMUST00000159410
AA Change: P14T

PolyPhen 2 Score 0.358 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000124182
Gene: ENSMUSG00000079022
AA Change: P14T

DomainStartEndE-ValueType
Pfam:Collagen 1 57 2.6e-11 PFAM
Pfam:Collagen 42 104 6.1e-12 PFAM
Pfam:Collagen 103 163 9.6e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000159993
AA Change: P569T

PolyPhen 2 Score 0.358 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000125069
Gene: ENSMUSG00000079022
AA Change: P569T

DomainStartEndE-ValueType
signal peptide 1 36 N/A INTRINSIC
VWA 45 227 1.35e-51 SMART
TSPN 248 436 1.26e-33 SMART
low complexity region 454 470 N/A INTRINSIC
internal_repeat_3 494 555 1.96e-13 PROSPERO
internal_repeat_1 496 643 1.49e-19 PROSPERO
low complexity region 644 657 N/A INTRINSIC
low complexity region 673 707 N/A INTRINSIC
Pfam:Collagen 751 823 1.5e-9 PFAM
Pfam:Collagen 810 863 2.3e-10 PFAM
Pfam:Collagen 869 931 4.8e-11 PFAM
Pfam:Collagen 926 990 1.1e-10 PFAM
Pfam:Collagen 1031 1087 1.7e-10 PFAM
Pfam:Collagen 1104 1162 1.8e-11 PFAM
low complexity region 1173 1227 N/A INTRINSIC
low complexity region 1236 1251 N/A INTRINSIC
internal_repeat_2 1257 1348 3.25e-18 PROSPERO
internal_repeat_4 1268 1347 9.67e-7 PROSPERO
Pfam:Collagen 1389 1448 4e-10 PFAM
Pfam:Collagen 1481 1540 2.6e-9 PFAM
low complexity region 1546 1558 N/A INTRINSIC
low complexity region 1580 1590 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162081
Predicted Effect unknown
Transcript: ENSMUST00000229585
AA Change: P14T
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] COL22A1, a member of the FACIT (fibrillar-associated collagens with interrupted triple helices) subgroup of the collagen protein family, specifically localizes to tissue junctions (Koch et al., 2004 [PubMed 15016833]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 106 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930518I15Rik C T 2: 156,857,154 probably benign Het
Abcb6 G A 1: 75,179,877 T81I probably benign Het
Acp6 A G 3: 97,175,759 K362R probably benign Het
Adam26a A G 8: 43,570,051 M134T probably benign Het
Ankrd27 C T 7: 35,628,490 P812S probably damaging Het
Arl6ip1 AAAATAAATAAATAAATAAATAAATA AAAATAAATAAATAAATAAATAAATAAATA 7: 118,121,899 probably benign Het
Atp2a1 G A 7: 126,448,623 R672C probably damaging Het
Atxn2 G T 5: 121,781,343 W371C probably damaging Het
B3gnt2 T TTCACAAA 11: 22,836,426 probably null Het
Btnl6 T A 17: 34,508,461 D365V possibly damaging Het
Ccdc80 T A 16: 45,095,565 L228Q probably damaging Het
Cdc42bpa A G 1: 180,109,194 H718R probably benign Het
Cdh18 A G 15: 23,474,368 K775E probably benign Het
Cdh23 T G 10: 60,337,666 N1679T possibly damaging Het
Cep192 T A 18: 67,815,922 D271E possibly damaging Het
Cfap70 G T 14: 20,443,661 T124K probably benign Het
Ckap5 A T 2: 91,578,131 E890D probably benign Het
Colq A T 14: 31,545,103 L150Q possibly damaging Het
Csf1 T C 3: 107,756,962 probably null Het
Csmd3 A T 15: 48,004,815 S770T possibly damaging Het
Cul9 C A 17: 46,530,146 V733L probably damaging Het
Cyp2c55 A G 19: 39,031,386 D256G possibly damaging Het
D17Wsu92e T C 17: 27,820,315 D7G probably damaging Het
Dclk3 A T 9: 111,469,185 D599V probably damaging Het
Defb26 T A 2: 152,508,184 I59F possibly damaging Het
Dnah6 A G 6: 73,129,660 V1646A possibly damaging Het
Dnm2 T C 9: 21,504,664 probably null Het
Dock6 A G 9: 21,802,540 L1867P probably damaging Het
Dock9 G T 14: 121,668,459 T93K probably damaging Het
Dync2h1 T C 9: 7,140,995 H1344R probably benign Het
Enam A C 5: 88,504,283 Q1217P possibly damaging Het
Fbf1 A T 11: 116,158,922 D91E possibly damaging Het
Fbxo7 T G 10: 86,046,802 W393G probably damaging Het
Gab2 A G 7: 97,304,213 T599A probably damaging Het
Gfy T A 7: 45,177,188 I409F possibly damaging Het
Gm19345 T A 7: 19,857,508 probably null Het
Gm4787 A G 12: 81,379,213 M57T probably benign Het
Gper1 A G 5: 139,426,725 E275G probably damaging Het
Grik4 T C 9: 42,524,586 E803G probably damaging Het
Gstm3 G A 3: 107,968,197 P39L possibly damaging Het
Hax1 A T 3: 89,997,460 V142D probably damaging Het
Hcn3 A T 3: 89,150,440 I383N probably damaging Het
Hdac10 C A 15: 89,125,397 probably null Het
Hipk3 A C 2: 104,439,329 M505R probably damaging Het
Hivep1 C T 13: 42,159,749 P1822S probably benign Het
Hsd17b13 G T 5: 103,956,258 H281N unknown Het
Irak2 T A 6: 113,672,887 I222N probably damaging Het
Kalrn G A 16: 34,513,926 L7F possibly damaging Het
Kcnma1 A G 14: 23,309,038 probably null Het
Kcnn3 G T 3: 89,520,420 probably benign Het
Lamb1 A C 12: 31,278,776 D218A probably damaging Het
Lrrtm1 A T 6: 77,244,144 N195Y probably damaging Het
Ltf A T 9: 111,022,341 N72I probably damaging Het
Mcm4 A G 16: 15,629,663 I479T probably damaging Het
Mfhas1 T C 8: 35,588,610 S80P probably benign Het
Mknk1 A G 4: 115,878,027 E364G probably damaging Het
Msh4 C T 3: 153,872,283 C458Y probably damaging Het
Mtrr A T 13: 68,564,512 probably null Het
Myo1a T C 10: 127,711,138 W356R probably damaging Het
Nbea A G 3: 55,723,648 V2186A probably benign Het
Nfe2l3 T C 6: 51,451,012 S185P probably damaging Het
Nhsl1 A C 10: 18,531,410 K1397Q probably damaging Het
Nmbr C T 10: 14,770,164 R261W probably damaging Het
Npy2r A G 3: 82,541,058 S137P probably damaging Het
Obscn C T 11: 59,080,205 G2494D probably damaging Het
Obscn T C 11: 59,122,746 K1092E probably damaging Het
Olfr1019 C T 2: 85,841,182 C203Y probably damaging Het
Oosp2 A C 19: 11,649,683 I92S probably benign Het
Pcdh9 T C 14: 93,887,180 D518G probably damaging Het
Pde11a G T 2: 76,337,793 T272K possibly damaging Het
Plekha2 T A 8: 25,059,835 Q162L probably null Het
Prkag2 T A 5: 24,878,734 I84F probably damaging Het
Prm2 G T 16: 10,791,749 probably benign Het
Prpf40a A T 2: 53,142,023 C800S probably damaging Het
Prr5l A T 2: 101,729,448 C158S probably benign Het
Prrt3 C A 6: 113,498,237 C8F possibly damaging Het
Psg25 T C 7: 18,529,803 T32A probably benign Het
Ruvbl1 T C 6: 88,485,905 V337A probably benign Het
Sall1 T A 8: 89,030,341 Q1045L probably damaging Het
Sec22c T C 9: 121,695,642 Y25C probably damaging Het
Serpina3i A T 12: 104,267,777 T335S possibly damaging Het
Setd1b TCCACCACCACCACCACCACCACCA TCCACCACCACCACCACCACCA 5: 123,152,074 probably benign Het
Slc12a8 T A 16: 33,608,159 I279N probably damaging Het
Slc15a1 G A 14: 121,489,907 T83I probably damaging Het
Slc22a3 A G 17: 12,459,771 F222S probably benign Het
Sorcs3 A T 19: 48,693,914 T463S probably benign Het
Spsb4 C A 9: 96,995,878 A131S probably benign Het
Syne2 A G 12: 75,967,710 E3225G probably damaging Het
Tchp G A 5: 114,719,573 probably null Het
Tekt4 T A 17: 25,471,775 D18E probably benign Het
Timm50 A G 7: 28,311,018 V37A probably benign Het
Tlx2 A C 6: 83,068,760 *285G probably null Het
Tmem173 T A 18: 35,738,690 I170F probably damaging Het
Tshz1 C A 18: 84,013,374 D970Y probably damaging Het
Ttn A T 2: 76,870,461 V50E probably damaging Het
Txndc17 T A 11: 72,209,448 S113T probably benign Het
Tyk2 T C 9: 21,108,009 Y1039C probably damaging Het
Ubqln3 A G 7: 104,142,491 S131P probably benign Het
Uncx A T 5: 139,544,082 H30L possibly damaging Het
Usp25 T A 16: 77,115,415 D1007E probably damaging Het
Usp47 T C 7: 112,101,831 V1083A probably damaging Het
Wdr24 T A 17: 25,828,505 H765Q probably damaging Het
Wrnip1 A G 13: 32,802,347 D37G probably damaging Het
Xpo6 T C 7: 126,113,752 T686A possibly damaging Het
Zfp941 G A 7: 140,812,211 R412C probably damaging Het
Znrf2 T A 6: 54,878,440 C71* probably null Het
Other mutations in Col22a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00162:Col22a1 APN 15 71860958 critical splice donor site probably null
IGL00434:Col22a1 APN 15 72006675 missense possibly damaging 0.71
IGL00721:Col22a1 APN 15 71846177 missense unknown
IGL00902:Col22a1 APN 15 71964659 missense probably damaging 1.00
IGL01311:Col22a1 APN 15 71973637 splice site probably benign
IGL01329:Col22a1 APN 15 71907040 missense probably benign 0.02
IGL01527:Col22a1 APN 15 71907031 missense probably damaging 0.98
IGL01870:Col22a1 APN 15 71952528 missense probably benign 0.07
IGL02002:Col22a1 APN 15 71811097 splice site probably benign
IGL02248:Col22a1 APN 15 71799448 missense unknown
IGL02322:Col22a1 APN 15 71822653 missense unknown
IGL02472:Col22a1 APN 15 71827753 splice site probably benign
IGL02685:Col22a1 APN 15 71801915 missense unknown
IGL02888:Col22a1 APN 15 71846219 missense unknown
IGL02971:Col22a1 APN 15 72006738 missense probably damaging 1.00
IGL03175:Col22a1 APN 15 71969103 missense possibly damaging 0.81
IGL03240:Col22a1 APN 15 71807928 missense unknown
R0083:Col22a1 UTSW 15 71890497 missense possibly damaging 0.70
R0383:Col22a1 UTSW 15 71869004 missense unknown
R0449:Col22a1 UTSW 15 71962671 critical splice donor site probably null
R0508:Col22a1 UTSW 15 71933413 missense unknown
R0944:Col22a1 UTSW 15 71881662 missense probably benign 0.03
R1289:Col22a1 UTSW 15 71837377 missense unknown
R1436:Col22a1 UTSW 15 71922957 splice site probably benign
R1439:Col22a1 UTSW 15 71952377 splice site probably benign
R1460:Col22a1 UTSW 15 71821931 missense unknown
R1680:Col22a1 UTSW 15 71799361 missense unknown
R1715:Col22a1 UTSW 15 72006981 missense possibly damaging 0.79
R1742:Col22a1 UTSW 15 71801913 missense unknown
R1745:Col22a1 UTSW 15 72006787 missense probably damaging 1.00
R1763:Col22a1 UTSW 15 72007176 missense probably damaging 0.96
R1932:Col22a1 UTSW 15 71870140 missense unknown
R2125:Col22a1 UTSW 15 71848577 missense unknown
R2126:Col22a1 UTSW 15 71857253 nonsense probably null
R2137:Col22a1 UTSW 15 72006948 missense possibly damaging 0.46
R2860:Col22a1 UTSW 15 71815943 critical splice donor site probably null
R2861:Col22a1 UTSW 15 71815943 critical splice donor site probably null
R2862:Col22a1 UTSW 15 71815943 critical splice donor site probably null
R3704:Col22a1 UTSW 15 71970307 missense probably damaging 1.00
R3778:Col22a1 UTSW 15 71973692 missense probably damaging 1.00
R3940:Col22a1 UTSW 15 71981933 nonsense probably null
R3950:Col22a1 UTSW 15 71977358 missense possibly damaging 0.90
R4240:Col22a1 UTSW 15 72007131 missense probably damaging 1.00
R4531:Col22a1 UTSW 15 72007149 missense probably damaging 1.00
R4597:Col22a1 UTSW 15 71964662 missense possibly damaging 0.83
R4654:Col22a1 UTSW 15 71973695 missense possibly damaging 0.95
R4782:Col22a1 UTSW 15 71801925 missense unknown
R4847:Col22a1 UTSW 15 71799499 missense unknown
R4980:Col22a1 UTSW 15 71801943 missense unknown
R4981:Col22a1 UTSW 15 71861066 missense unknown
R4996:Col22a1 UTSW 15 72007161 missense probably damaging 0.99
R5007:Col22a1 UTSW 15 71944422 missense probably damaging 1.00
R5135:Col22a1 UTSW 15 71799337 missense unknown
R5197:Col22a1 UTSW 15 72009406 missense probably damaging 0.96
R5292:Col22a1 UTSW 15 71970336 missense probably damaging 1.00
R5449:Col22a1 UTSW 15 71821949 missense unknown
R5480:Col22a1 UTSW 15 71964611 missense probably damaging 0.98
R5627:Col22a1 UTSW 15 71981918 missense probably damaging 0.98
R5828:Col22a1 UTSW 15 72009491 missense probably benign 0.01
R5927:Col22a1 UTSW 15 72006966 missense probably damaging 1.00
R6006:Col22a1 UTSW 15 71973836 missense probably damaging 1.00
R6245:Col22a1 UTSW 15 71973816 missense probably damaging 0.99
R6288:Col22a1 UTSW 15 71894869 critical splice acceptor site probably null
R6482:Col22a1 UTSW 15 71890489 missense possibly damaging 0.93
R6497:Col22a1 UTSW 15 71890576 missense possibly damaging 0.85
R6579:Col22a1 UTSW 15 71881653 missense probably benign 0.18
R6643:Col22a1 UTSW 15 71822037 intron probably null
R6663:Col22a1 UTSW 15 71820059 missense unknown
R7179:Col22a1 UTSW 15 71933413 missense unknown
R7215:Col22a1 UTSW 15 71970332 nonsense probably null
R7216:Col22a1 UTSW 15 71973845 missense probably damaging 1.00
R7505:Col22a1 UTSW 15 71799399 nonsense probably null
R7585:Col22a1 UTSW 15 71892205 missense probably damaging 0.99
R7788:Col22a1 UTSW 15 71952317 critical splice donor site probably null
X0066:Col22a1 UTSW 15 71801879 missense unknown
X0066:Col22a1 UTSW 15 71846200 missense unknown
Y5406:Col22a1 UTSW 15 71799515 missense unknown
Predicted Primers PCR Primer
(F):5'- AGGATGACCCCTCAAGTCTC -3'
(R):5'- TGTCACCACTCAGCAATTCATC -3'

Sequencing Primer
(F):5'- CAACTGTATGCCCCACTATTGTAAGG -3'
(R):5'- ACTCAGCAATTCATCTCTGGTAG -3'
Posted On2015-09-25