Incidental Mutation 'R4605:Maip1'
ID345952
Institutional Source Beutler Lab
Gene Symbol Maip1
Ensembl Gene ENSMUSG00000025971
Gene Namematrix AAA peptidase interacting protein 1
Synonyms9430016H08Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.099) question?
Stock #R4605 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location57406328-57417953 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 57411732 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 178 (I178V)
Ref Sequence ENSEMBL: ENSMUSP00000027114 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027114] [ENSMUST00000162686]
Predicted Effect probably benign
Transcript: ENSMUST00000027114
AA Change: I178V

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000027114
Gene: ENSMUSG00000025971
AA Change: I178V

DomainStartEndE-ValueType
low complexity region 2 18 N/A INTRINSIC
low complexity region 66 78 N/A INTRINSIC
low complexity region 82 93 N/A INTRINSIC
low complexity region 98 109 N/A INTRINSIC
Blast:Tim44 131 210 3e-11 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000162686
SMART Domains Protein: ENSMUSP00000125427
Gene: ENSMUSG00000048495

DomainStartEndE-ValueType
JmjC 105 265 5.8e-3 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000185709
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931408C20Rik T C 1: 26,683,186 K971R probably benign Het
Ankra2 A G 13: 98,266,234 probably benign Het
Atp9b T A 18: 80,753,149 probably null Het
Birc6 G A 17: 74,639,934 D2885N probably damaging Het
Chaf1b A T 16: 93,888,089 N142I possibly damaging Het
Ckap5 G A 2: 91,576,214 G787S probably damaging Het
Ctc1 G T 11: 69,029,726 C372F possibly damaging Het
Dip2b A G 15: 100,209,636 T1176A probably benign Het
Epha10 A G 4: 124,885,757 E132G probably damaging Het
Extl1 A G 4: 134,359,834 V471A probably benign Het
Fgd6 T C 10: 94,044,355 L357P probably benign Het
Gapvd1 A T 2: 34,728,537 C275S probably damaging Het
Kcnj2 G A 11: 111,072,850 C356Y probably damaging Het
Kcnk10 T C 12: 98,489,960 D204G probably damaging Het
Krtap9-1 A C 11: 99,873,753 E105A unknown Het
Loxhd1 G A 18: 77,405,946 V668I probably benign Het
Ly86 T C 13: 37,375,011 I62T possibly damaging Het
Mical3 G A 6: 121,034,080 Q386* probably null Het
Olfr1057 G A 2: 86,374,797 T205I probably benign Het
Olfr1461 T A 19: 13,165,248 V78D probably damaging Het
Olfr235 T C 19: 12,269,168 *313Q probably null Het
Olfr472 A C 7: 107,903,238 I174L probably benign Het
Pcdha12 T C 18: 37,021,523 S432P probably damaging Het
Prex1 A T 2: 166,713,544 Y59N probably benign Het
Sbf1 A G 15: 89,303,481 F654L probably damaging Het
Sh2d5 T A 4: 138,257,255 Y187* probably null Het
Slc9a4 T C 1: 40,601,035 probably null Het
Smyd2 A G 1: 189,897,426 S136P probably damaging Het
Srsf11 A T 3: 158,022,923 L115* probably null Het
Tbx19 C T 1: 165,153,584 V114I possibly damaging Het
Unc5b A G 10: 60,774,403 V545A probably benign Het
Ush2a A G 1: 188,910,801 Y4120C probably damaging Het
Vps13a T C 19: 16,640,039 T3002A probably damaging Het
Zkscan2 A T 7: 123,498,724 W150R probably damaging Het
Other mutations in Maip1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02732:Maip1 APN 1 57409955 missense probably damaging 1.00
IGL03064:Maip1 APN 1 57407200 missense probably damaging 1.00
R0403:Maip1 UTSW 1 57407196 missense probably benign 0.14
R0411:Maip1 UTSW 1 57415693 missense probably damaging 1.00
R0732:Maip1 UTSW 1 57411835 missense probably damaging 1.00
R1569:Maip1 UTSW 1 57413395 splice site probably benign
R1620:Maip1 UTSW 1 57409985 critical splice donor site probably null
R2830:Maip1 UTSW 1 57415663 missense possibly damaging 0.53
R4574:Maip1 UTSW 1 57413245 missense possibly damaging 0.90
R5082:Maip1 UTSW 1 57411851 critical splice donor site probably null
R5178:Maip1 UTSW 1 57415690 missense probably benign 0.06
R5262:Maip1 UTSW 1 57406972 missense probably damaging 0.96
R5883:Maip1 UTSW 1 57407101 missense probably damaging 0.99
R6837:Maip1 UTSW 1 57415732 makesense probably null
R7445:Maip1 UTSW 1 57407031 missense possibly damaging 0.79
R7687:Maip1 UTSW 1 57411844 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- AAGATTATATGCCCCAGTACAGG -3'
(R):5'- ACTCACAGCTTTGGTTTACTTGAAC -3'

Sequencing Primer
(F):5'- CCAGTACAGGGGAATGCC -3'
(R):5'- ACAATTATTTGTCATGTAAAGTTGCC -3'
Posted On2015-09-25