Incidental Mutation 'R4605:Tbx19'
List |< first << previous [record 31 of 35] next >> last >|
ID345954
Institutional Source Beutler Lab
Gene Symbol Tbx19
Ensembl Gene ENSMUSG00000026572
Gene NameT-box 19
SynonymsTpit, D1Ertd754e
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.930) question?
Stock #R4605 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location165137855-165160773 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 165153584 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 114 (V114I)
Ref Sequence ENSEMBL: ENSMUSP00000027859 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027859]
Predicted Effect possibly damaging
Transcript: ENSMUST00000027859
AA Change: V114I

PolyPhen 2 Score 0.869 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000027859
Gene: ENSMUSG00000026572
AA Change: V114I

DomainStartEndE-ValueType
TBOX 38 221 1.26e-114 SMART
low complexity region 263 275 N/A INTRINSIC
Blast:TBOX 343 410 2e-18 BLAST
low complexity region 424 443 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160350
Predicted Effect unknown
Transcript: ENSMUST00000161144
AA Change: V48I
SMART Domains Protein: ENSMUSP00000123909
Gene: ENSMUSG00000026572
AA Change: V48I

DomainStartEndE-ValueType
TBOX 1 156 4.56e-80 SMART
Blast:TBOX 215 282 5e-19 BLAST
low complexity region 296 315 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161777
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162550
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of a family of transcription factors containing a characteristic T-box DNA-binding domain. The encoded protein promotes expression of the pro-opiomelanocortin (POMC) gene, which is important for the differentiation of cells in the pituitary gland. [provided by RefSeq, Mar 2013]
PHENOTYPE: The phenotype of homozygous null mice is similar to that of patients with early onset pituitary ACTH deficiency. They are characterized by fasting-induced hypoglycemia due to an impaired pituitary-adrenal axis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931408C20Rik T C 1: 26,683,186 K971R probably benign Het
Ankra2 A G 13: 98,266,234 probably benign Het
Atp9b T A 18: 80,753,149 probably null Het
Birc6 G A 17: 74,639,934 D2885N probably damaging Het
Chaf1b A T 16: 93,888,089 N142I possibly damaging Het
Ckap5 G A 2: 91,576,214 G787S probably damaging Het
Ctc1 G T 11: 69,029,726 C372F possibly damaging Het
Dip2b A G 15: 100,209,636 T1176A probably benign Het
Epha10 A G 4: 124,885,757 E132G probably damaging Het
Extl1 A G 4: 134,359,834 V471A probably benign Het
Fgd6 T C 10: 94,044,355 L357P probably benign Het
Gapvd1 A T 2: 34,728,537 C275S probably damaging Het
Kcnj2 G A 11: 111,072,850 C356Y probably damaging Het
Kcnk10 T C 12: 98,489,960 D204G probably damaging Het
Krtap9-1 A C 11: 99,873,753 E105A unknown Het
Loxhd1 G A 18: 77,405,946 V668I probably benign Het
Ly86 T C 13: 37,375,011 I62T possibly damaging Het
Maip1 A G 1: 57,411,732 I178V probably benign Het
Mical3 G A 6: 121,034,080 Q386* probably null Het
Olfr1057 G A 2: 86,374,797 T205I probably benign Het
Olfr1461 T A 19: 13,165,248 V78D probably damaging Het
Olfr235 T C 19: 12,269,168 *313Q probably null Het
Olfr472 A C 7: 107,903,238 I174L probably benign Het
Pcdha12 T C 18: 37,021,523 S432P probably damaging Het
Prex1 A T 2: 166,713,544 Y59N probably benign Het
Sbf1 A G 15: 89,303,481 F654L probably damaging Het
Sh2d5 T A 4: 138,257,255 Y187* probably null Het
Slc9a4 T C 1: 40,601,035 probably null Het
Smyd2 A G 1: 189,897,426 S136P probably damaging Het
Srsf11 A T 3: 158,022,923 L115* probably null Het
Unc5b A G 10: 60,774,403 V545A probably benign Het
Ush2a A G 1: 188,910,801 Y4120C probably damaging Het
Vps13a T C 19: 16,640,039 T3002A probably damaging Het
Zkscan2 A T 7: 123,498,724 W150R probably damaging Het
Other mutations in Tbx19
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00561:Tbx19 APN 1 165160399 missense probably benign 0.05
IGL00849:Tbx19 APN 1 165152040 missense probably benign 0.08
IGL01545:Tbx19 APN 1 165139156 missense possibly damaging 0.77
IGL01893:Tbx19 APN 1 165140198 missense possibly damaging 0.93
IGL02451:Tbx19 APN 1 165140171 missense probably benign 0.03
IGL02514:Tbx19 APN 1 165153704 missense probably benign 0.15
R0009:Tbx19 UTSW 1 165160520 missense possibly damaging 0.93
R0009:Tbx19 UTSW 1 165160520 missense possibly damaging 0.93
R1600:Tbx19 UTSW 1 165142567 missense possibly damaging 0.52
R5410:Tbx19 UTSW 1 165160372 missense probably damaging 0.99
R5441:Tbx19 UTSW 1 165153680 missense probably damaging 0.99
R6814:Tbx19 UTSW 1 165147633 critical splice donor site probably null
R6822:Tbx19 UTSW 1 165140140 missense probably damaging 0.98
R6872:Tbx19 UTSW 1 165147633 critical splice donor site probably null
R7078:Tbx19 UTSW 1 165160566 start gained probably benign
R7711:Tbx19 UTSW 1 165139199 missense probably benign
Z1176:Tbx19 UTSW 1 165142507 missense not run
Z1177:Tbx19 UTSW 1 165142574 missense not run
Predicted Primers PCR Primer
(F):5'- AAATAACCGGCTTCTGTGGG -3'
(R):5'- GATCCCTACACAGCTGTTTCTG -3'

Sequencing Primer
(F):5'- GAGGACCTCTCTAATTGCCTAAATGC -3'
(R):5'- TCTGACTTCTTTCAGACGGATG -3'
Posted On2015-09-25