Incidental Mutation 'R4605:Smyd2'
ID345956
Institutional Source Beutler Lab
Gene Symbol Smyd2
Ensembl Gene ENSMUSG00000026603
Gene NameSET and MYND domain containing 2
SynonymsZmynd14, KMT3C, 1110020E07Rik
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4605 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location189880492-189922363 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 189897426 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 136 (S136P)
Ref Sequence ENSEMBL: ENSMUSP00000027897 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027897]
PDB Structure
Crystal structure of histone lysine methyltransferase SmyD2 in complex with the cofactor product AdoHcy [X-RAY DIFFRACTION]
Crystal structure of histone lysine methyltransferase SmyD2 in complex with the methyltransferase inhibitor sinefungin [X-RAY DIFFRACTION]
Predicted Effect probably damaging
Transcript: ENSMUST00000027897
AA Change: S136P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000027897
Gene: ENSMUSG00000026603
AA Change: S136P

DomainStartEndE-ValueType
SET 7 247 2.88e-2 SMART
SCOP:d1elra_ 344 411 8e-5 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144452
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] SET domain-containing proteins, such as SMYD2, catalyze lysine methylation (Brown et al., 2006 [PubMed 16805913]).[supplied by OMIM, Nov 2008]
PHENOTYPE: Mice homozygous for a targeted allele exhibit increased circulating total and LDL cholesterol levels and decreased circulating sodium and chloride levels. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931408C20Rik T C 1: 26,683,186 K971R probably benign Het
Ankra2 A G 13: 98,266,234 probably benign Het
Atp9b T A 18: 80,753,149 probably null Het
Birc6 G A 17: 74,639,934 D2885N probably damaging Het
Chaf1b A T 16: 93,888,089 N142I possibly damaging Het
Ckap5 G A 2: 91,576,214 G787S probably damaging Het
Ctc1 G T 11: 69,029,726 C372F possibly damaging Het
Dip2b A G 15: 100,209,636 T1176A probably benign Het
Epha10 A G 4: 124,885,757 E132G probably damaging Het
Extl1 A G 4: 134,359,834 V471A probably benign Het
Fgd6 T C 10: 94,044,355 L357P probably benign Het
Gapvd1 A T 2: 34,728,537 C275S probably damaging Het
Kcnj2 G A 11: 111,072,850 C356Y probably damaging Het
Kcnk10 T C 12: 98,489,960 D204G probably damaging Het
Krtap9-1 A C 11: 99,873,753 E105A unknown Het
Loxhd1 G A 18: 77,405,946 V668I probably benign Het
Ly86 T C 13: 37,375,011 I62T possibly damaging Het
Maip1 A G 1: 57,411,732 I178V probably benign Het
Mical3 G A 6: 121,034,080 Q386* probably null Het
Olfr1057 G A 2: 86,374,797 T205I probably benign Het
Olfr1461 T A 19: 13,165,248 V78D probably damaging Het
Olfr235 T C 19: 12,269,168 *313Q probably null Het
Olfr472 A C 7: 107,903,238 I174L probably benign Het
Pcdha12 T C 18: 37,021,523 S432P probably damaging Het
Prex1 A T 2: 166,713,544 Y59N probably benign Het
Sbf1 A G 15: 89,303,481 F654L probably damaging Het
Sh2d5 T A 4: 138,257,255 Y187* probably null Het
Slc9a4 T C 1: 40,601,035 probably null Het
Srsf11 A T 3: 158,022,923 L115* probably null Het
Tbx19 C T 1: 165,153,584 V114I possibly damaging Het
Unc5b A G 10: 60,774,403 V545A probably benign Het
Ush2a A G 1: 188,910,801 Y4120C probably damaging Het
Vps13a T C 19: 16,640,039 T3002A probably damaging Het
Zkscan2 A T 7: 123,498,724 W150R probably damaging Het
Other mutations in Smyd2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00480:Smyd2 APN 1 189899846 missense probably damaging 1.00
IGL01060:Smyd2 APN 1 189897470 missense possibly damaging 0.66
IGL01938:Smyd2 APN 1 189888882 missense probably benign 0.05
IGL02113:Smyd2 APN 1 189882217 missense probably damaging 0.99
IGL03075:Smyd2 APN 1 189888832 missense probably damaging 0.98
R0739:Smyd2 UTSW 1 189888862 missense possibly damaging 0.50
R2108:Smyd2 UTSW 1 189897426 missense probably damaging 1.00
R2497:Smyd2 UTSW 1 189885337 missense possibly damaging 0.93
R4466:Smyd2 UTSW 1 189882152 missense probably benign 0.09
R4672:Smyd2 UTSW 1 189909904 missense probably damaging 1.00
R4872:Smyd2 UTSW 1 189896650 missense probably damaging 1.00
R4963:Smyd2 UTSW 1 189882188 missense probably damaging 1.00
R5419:Smyd2 UTSW 1 189909893 nonsense probably null
R5660:Smyd2 UTSW 1 189885382 missense possibly damaging 0.95
R6271:Smyd2 UTSW 1 189883852 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTAGCGTGTCCTGACAGACTTG -3'
(R):5'- AAAATAAGCCCTTTGGATCTGGAG -3'

Sequencing Primer
(F):5'- TGACAGACTTGTACACTCGGG -3'
(R):5'- CAAGTGTGGACTCCTCAAGTAG -3'
Posted On2015-09-25