Incidental Mutation 'R4605:Olfr1057'
List |< first << previous [record 20 of 35] next >> last >|
ID345958
Institutional Source Beutler Lab
Gene Symbol Olfr1057
Ensembl Gene ENSMUSG00000075187
Gene Nameolfactory receptor 1057
SynonymsGA_x6K02T2Q125-47844843-47843896, MOR185-11
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.068) question?
Stock #R4605 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location86372561-86378393 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 86374797 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 205 (T205I)
Ref Sequence ENSEMBL: ENSMUSP00000150623 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099892] [ENSMUST00000217435]
Predicted Effect probably benign
Transcript: ENSMUST00000099892
AA Change: T205I

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
SMART Domains Protein: ENSMUSP00000097477
Gene: ENSMUSG00000075187
AA Change: T205I

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 8.3e-47 PFAM
Pfam:7tm_1 41 290 1.4e-20 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000217435
AA Change: T205I

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931408C20Rik T C 1: 26,683,186 K971R probably benign Het
Ankra2 A G 13: 98,266,234 probably benign Het
Atp9b T A 18: 80,753,149 probably null Het
Birc6 G A 17: 74,639,934 D2885N probably damaging Het
Chaf1b A T 16: 93,888,089 N142I possibly damaging Het
Ckap5 G A 2: 91,576,214 G787S probably damaging Het
Ctc1 G T 11: 69,029,726 C372F possibly damaging Het
Dip2b A G 15: 100,209,636 T1176A probably benign Het
Epha10 A G 4: 124,885,757 E132G probably damaging Het
Extl1 A G 4: 134,359,834 V471A probably benign Het
Fgd6 T C 10: 94,044,355 L357P probably benign Het
Gapvd1 A T 2: 34,728,537 C275S probably damaging Het
Kcnj2 G A 11: 111,072,850 C356Y probably damaging Het
Kcnk10 T C 12: 98,489,960 D204G probably damaging Het
Krtap9-1 A C 11: 99,873,753 E105A unknown Het
Loxhd1 G A 18: 77,405,946 V668I probably benign Het
Ly86 T C 13: 37,375,011 I62T possibly damaging Het
Maip1 A G 1: 57,411,732 I178V probably benign Het
Mical3 G A 6: 121,034,080 Q386* probably null Het
Olfr1461 T A 19: 13,165,248 V78D probably damaging Het
Olfr235 T C 19: 12,269,168 *313Q probably null Het
Olfr472 A C 7: 107,903,238 I174L probably benign Het
Pcdha12 T C 18: 37,021,523 S432P probably damaging Het
Prex1 A T 2: 166,713,544 Y59N probably benign Het
Sbf1 A G 15: 89,303,481 F654L probably damaging Het
Sh2d5 T A 4: 138,257,255 Y187* probably null Het
Slc9a4 T C 1: 40,601,035 probably null Het
Smyd2 A G 1: 189,897,426 S136P probably damaging Het
Srsf11 A T 3: 158,022,923 L115* probably null Het
Tbx19 C T 1: 165,153,584 V114I possibly damaging Het
Unc5b A G 10: 60,774,403 V545A probably benign Het
Ush2a A G 1: 188,910,801 Y4120C probably damaging Het
Vps13a T C 19: 16,640,039 T3002A probably damaging Het
Zkscan2 A T 7: 123,498,724 W150R probably damaging Het
Other mutations in Olfr1057
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02403:Olfr1057 APN 2 86374523 missense probably benign 0.05
IGL03267:Olfr1057 APN 2 86374634 nonsense probably null
R0133:Olfr1057 UTSW 2 86374815 missense possibly damaging 0.95
R0993:Olfr1057 UTSW 2 86374878 missense probably damaging 0.99
R1386:Olfr1057 UTSW 2 86374921 missense probably damaging 1.00
R1830:Olfr1057 UTSW 2 86375143 missense possibly damaging 0.95
R2398:Olfr1057 UTSW 2 86374839 missense probably damaging 0.98
R3753:Olfr1057 UTSW 2 86374915 missense possibly damaging 0.53
R4394:Olfr1057 UTSW 2 86375179 missense possibly damaging 0.77
R4835:Olfr1057 UTSW 2 86374509 missense possibly damaging 0.93
R5029:Olfr1057 UTSW 2 86374890 missense probably damaging 1.00
R5311:Olfr1057 UTSW 2 86374750 missense possibly damaging 0.91
R7487:Olfr1057 UTSW 2 86375131 missense probably damaging 1.00
R7667:Olfr1057 UTSW 2 86375181 missense probably damaging 0.99
R7770:Olfr1057 UTSW 2 86375260 missense possibly damaging 0.53
R7888:Olfr1057 UTSW 2 86374926 missense probably benign 0.02
R7971:Olfr1057 UTSW 2 86374926 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- AGTCCGTGGTTGTAGATACATG -3'
(R):5'- CAACCCACTGCTCTACATGG -3'

Sequencing Primer
(F):5'- TCCGTGGTTGTAGATACATGAAGAG -3'
(R):5'- CCACTGCTCTACATGGTGGTG -3'
Posted On2015-09-25