Incidental Mutation 'R4605:Epha10'
List |< first << previous [record 9 of 35] next >> last >|
ID345963
Institutional Source Beutler Lab
Gene Symbol Epha10
Ensembl Gene ENSMUSG00000028876
Gene NameEph receptor A10
Synonyms
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4605 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location124880899-124917800 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 124885757 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 132 (E132G)
Ref Sequence ENSEMBL: ENSMUSP00000050810 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000059343]
Predicted Effect probably damaging
Transcript: ENSMUST00000059343
AA Change: E132G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000050810
Gene: ENSMUSG00000028876
AA Change: E132G

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
EPH_lbd 35 211 2.5e-109 SMART
low complexity region 219 232 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000149146
SMART Domains Protein: ENSMUSP00000118801
Gene: ENSMUSG00000028876

DomainStartEndE-ValueType
Pfam:Ephrin_lbd 1 66 2.2e-25 PFAM
low complexity region 74 87 N/A INTRINSIC
FN3 193 290 6.54e-6 SMART
FN3 306 392 1.66e-7 SMART
Pfam:EphA2_TM 421 496 2.4e-15 PFAM
TyrKc 499 754 5.17e-90 SMART
SAM 784 851 1.2e-15 SMART
low complexity region 852 862 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Ephrin receptors, the largest subfamily of receptor tyrosine kinases (RTKs), and their ephrin ligands are important mediators of cell-cell communication regulating cell attachment, shape, and mobility in neuronal and epithelial cells (Aasheim et al., 2005 [PubMed 15777695]). See MIM 179610 for additional background on Eph receptors and ephrins.[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931408C20Rik T C 1: 26,683,186 K971R probably benign Het
Ankra2 A G 13: 98,266,234 probably benign Het
Atp9b T A 18: 80,753,149 probably null Het
Birc6 G A 17: 74,639,934 D2885N probably damaging Het
Chaf1b A T 16: 93,888,089 N142I possibly damaging Het
Ckap5 G A 2: 91,576,214 G787S probably damaging Het
Ctc1 G T 11: 69,029,726 C372F possibly damaging Het
Dip2b A G 15: 100,209,636 T1176A probably benign Het
Extl1 A G 4: 134,359,834 V471A probably benign Het
Fgd6 T C 10: 94,044,355 L357P probably benign Het
Gapvd1 A T 2: 34,728,537 C275S probably damaging Het
Kcnj2 G A 11: 111,072,850 C356Y probably damaging Het
Kcnk10 T C 12: 98,489,960 D204G probably damaging Het
Krtap9-1 A C 11: 99,873,753 E105A unknown Het
Loxhd1 G A 18: 77,405,946 V668I probably benign Het
Ly86 T C 13: 37,375,011 I62T possibly damaging Het
Maip1 A G 1: 57,411,732 I178V probably benign Het
Mical3 G A 6: 121,034,080 Q386* probably null Het
Olfr1057 G A 2: 86,374,797 T205I probably benign Het
Olfr1461 T A 19: 13,165,248 V78D probably damaging Het
Olfr235 T C 19: 12,269,168 *313Q probably null Het
Olfr472 A C 7: 107,903,238 I174L probably benign Het
Pcdha12 T C 18: 37,021,523 S432P probably damaging Het
Prex1 A T 2: 166,713,544 Y59N probably benign Het
Sbf1 A G 15: 89,303,481 F654L probably damaging Het
Sh2d5 T A 4: 138,257,255 Y187* probably null Het
Slc9a4 T C 1: 40,601,035 probably null Het
Smyd2 A G 1: 189,897,426 S136P probably damaging Het
Srsf11 A T 3: 158,022,923 L115* probably null Het
Tbx19 C T 1: 165,153,584 V114I possibly damaging Het
Unc5b A G 10: 60,774,403 V545A probably benign Het
Ush2a A G 1: 188,910,801 Y4120C probably damaging Het
Vps13a T C 19: 16,640,039 T3002A probably damaging Het
Zkscan2 A T 7: 123,498,724 W150R probably damaging Het
Other mutations in Epha10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01969:Epha10 APN 4 124885877 missense probably damaging 1.00
R1319:Epha10 UTSW 4 124881914 missense probably benign
R1544:Epha10 UTSW 4 124885596 missense probably damaging 1.00
R4504:Epha10 UTSW 4 124915687 unclassified probably benign
R4505:Epha10 UTSW 4 124915687 unclassified probably benign
R4507:Epha10 UTSW 4 124915687 unclassified probably benign
R4572:Epha10 UTSW 4 124902568 missense unknown
R4818:Epha10 UTSW 4 124886214 critical splice donor site probably null
R5037:Epha10 UTSW 4 124915385 unclassified probably benign
R5281:Epha10 UTSW 4 124913988 unclassified probably benign
R5319:Epha10 UTSW 4 124914000 unclassified probably benign
R5322:Epha10 UTSW 4 124885748 missense probably damaging 1.00
R5400:Epha10 UTSW 4 124914121 unclassified probably benign
R5681:Epha10 UTSW 4 124902566 missense unknown
R5694:Epha10 UTSW 4 124902653 missense unknown
R6813:Epha10 UTSW 4 124902693 missense
R7471:Epha10 UTSW 4 124902572 missense
R7732:Epha10 UTSW 4 124915299 missense
R7735:Epha10 UTSW 4 124913679 missense
R7793:Epha10 UTSW 4 124914453 missense probably benign 0.00
R7899:Epha10 UTSW 4 124914835 missense
R7982:Epha10 UTSW 4 124914835 missense
R8057:Epha10 UTSW 4 124902683 missense not run
X0026:Epha10 UTSW 4 124885547 missense probably damaging 1.00
Z1176:Epha10 UTSW 4 124883942 missense not run
Z1176:Epha10 UTSW 4 124885775 missense not run
Z1177:Epha10 UTSW 4 124881960 missense not run
Predicted Primers PCR Primer
(F):5'- ACCAAGTGTGCAACGTGCTG -3'
(R):5'- TGTAGTAGACACGCACCGAG -3'

Sequencing Primer
(F):5'- AACGTGCTGGAGCCCAAC -3'
(R):5'- ACCCACGTCCTGGAAGG -3'
Posted On2015-09-25