Incidental Mutation 'R4605:Sh2d5'
List |< first << previous [record 27 of 35] next >> last >|
ID345964
Institutional Source Beutler Lab
Gene Symbol Sh2d5
Ensembl Gene ENSMUSG00000045349
Gene NameSH2 domain containing 5
Synonyms
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4605 (G1)
Quality Score215
Status Not validated
Chromosome4
Chromosomal Location138250403-138261332 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to A at 138257255 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Stop codon at position 187 (Y187*)
Ref Sequence ENSEMBL: ENSMUSP00000119052 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030539] [ENSMUST00000105818] [ENSMUST00000105823] [ENSMUST00000105824] [ENSMUST00000124239]
Predicted Effect probably benign
Transcript: ENSMUST00000030539
SMART Domains Protein: ENSMUSP00000030539
Gene: ENSMUSG00000028758

DomainStartEndE-ValueType
KISc 3 343 4.57e-178 SMART
coiled coil region 400 470 N/A INTRINSIC
low complexity region 723 736 N/A INTRINSIC
coiled coil region 806 852 N/A INTRINSIC
low complexity region 983 1000 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000105818
SMART Domains Protein: ENSMUSP00000101444
Gene: ENSMUSG00000028758

DomainStartEndE-ValueType
KISc 1 151 1.46e-13 SMART
coiled coil region 208 278 N/A INTRINSIC
low complexity region 532 545 N/A INTRINSIC
coiled coil region 615 661 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000105823
AA Change: Y261*
SMART Domains Protein: ENSMUSP00000101449
Gene: ENSMUSG00000045349
AA Change: Y261*

DomainStartEndE-ValueType
Pfam:PID 27 149 1e-6 PFAM
SH2 300 384 9.29e-2 SMART
Predicted Effect probably null
Transcript: ENSMUST00000105824
AA Change: Y261*
SMART Domains Protein: ENSMUSP00000101450
Gene: ENSMUSG00000045349
AA Change: Y261*

DomainStartEndE-ValueType
SCOP:d1ddma_ 24 146 8e-18 SMART
Blast:PTB 28 146 6e-6 BLAST
SH2 300 384 9.29e-2 SMART
Predicted Effect probably null
Transcript: ENSMUST00000124239
AA Change: Y187*
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139033
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154421
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931408C20Rik T C 1: 26,683,186 K971R probably benign Het
Ankra2 A G 13: 98,266,234 probably benign Het
Atp9b T A 18: 80,753,149 probably null Het
Birc6 G A 17: 74,639,934 D2885N probably damaging Het
Chaf1b A T 16: 93,888,089 N142I possibly damaging Het
Ckap5 G A 2: 91,576,214 G787S probably damaging Het
Ctc1 G T 11: 69,029,726 C372F possibly damaging Het
Dip2b A G 15: 100,209,636 T1176A probably benign Het
Epha10 A G 4: 124,885,757 E132G probably damaging Het
Extl1 A G 4: 134,359,834 V471A probably benign Het
Fgd6 T C 10: 94,044,355 L357P probably benign Het
Gapvd1 A T 2: 34,728,537 C275S probably damaging Het
Kcnj2 G A 11: 111,072,850 C356Y probably damaging Het
Kcnk10 T C 12: 98,489,960 D204G probably damaging Het
Krtap9-1 A C 11: 99,873,753 E105A unknown Het
Loxhd1 G A 18: 77,405,946 V668I probably benign Het
Ly86 T C 13: 37,375,011 I62T possibly damaging Het
Maip1 A G 1: 57,411,732 I178V probably benign Het
Mical3 G A 6: 121,034,080 Q386* probably null Het
Olfr1057 G A 2: 86,374,797 T205I probably benign Het
Olfr1461 T A 19: 13,165,248 V78D probably damaging Het
Olfr235 T C 19: 12,269,168 *313Q probably null Het
Olfr472 A C 7: 107,903,238 I174L probably benign Het
Pcdha12 T C 18: 37,021,523 S432P probably damaging Het
Prex1 A T 2: 166,713,544 Y59N probably benign Het
Sbf1 A G 15: 89,303,481 F654L probably damaging Het
Slc9a4 T C 1: 40,601,035 probably null Het
Smyd2 A G 1: 189,897,426 S136P probably damaging Het
Srsf11 A T 3: 158,022,923 L115* probably null Het
Tbx19 C T 1: 165,153,584 V114I possibly damaging Het
Unc5b A G 10: 60,774,403 V545A probably benign Het
Ush2a A G 1: 188,910,801 Y4120C probably damaging Het
Vps13a T C 19: 16,640,039 T3002A probably damaging Het
Zkscan2 A T 7: 123,498,724 W150R probably damaging Het
Other mutations in Sh2d5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02150:Sh2d5 APN 4 138258242 missense probably benign 0.19
IGL02715:Sh2d5 APN 4 138256707 splice site probably benign
R0621:Sh2d5 UTSW 4 138258318 missense probably benign 0.12
R0622:Sh2d5 UTSW 4 138259228 missense probably damaging 0.97
R4828:Sh2d5 UTSW 4 138258255 missense probably damaging 1.00
R5372:Sh2d5 UTSW 4 138254699 missense possibly damaging 0.95
R6053:Sh2d5 UTSW 4 138255562 missense probably damaging 0.96
R6441:Sh2d5 UTSW 4 138259082 missense possibly damaging 0.95
R7336:Sh2d5 UTSW 4 138256839 missense probably benign
R7621:Sh2d5 UTSW 4 138256839 missense probably benign 0.01
R7642:Sh2d5 UTSW 4 138259156 missense probably benign 0.05
R7828:Sh2d5 UTSW 4 138256797 missense probably benign 0.09
Predicted Primers PCR Primer
(F):5'- AGTCTGAATCTGCCTGCCTG -3'
(R):5'- GTCACACATCTGGTCCCTCAAC -3'

Sequencing Primer
(F):5'- CTGTGGGCCCCTCTCGG -3'
(R):5'- ACAATTGCTTTGTGGTCTGCATAAG -3'
Posted On2015-09-25