Incidental Mutation 'R4605:Zkscan2'
List |< first << previous [record 35 of 35]
ID345968
Institutional Source Beutler Lab
Gene Symbol Zkscan2
Ensembl Gene ENSMUSG00000030757
Gene Namezinc finger with KRAB and SCAN domains 2
Synonyms9430065N20Rik, Zfp694
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.095) question?
Stock #R4605 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location123475384-123500449 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 123498724 bp
ZygosityHeterozygous
Amino Acid Change Tryptophan to Arginine at position 150 (W150R)
Ref Sequence ENSEMBL: ENSMUSP00000041821 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042470] [ENSMUST00000128217]
Predicted Effect probably damaging
Transcript: ENSMUST00000042470
AA Change: W150R

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000041821
Gene: ENSMUSG00000030757
AA Change: W150R

DomainStartEndE-ValueType
SCAN 41 148 1.62e-54 SMART
KRAB 222 282 1.71e-2 SMART
SANT 333 397 3.73e0 SMART
low complexity region 449 469 N/A INTRINSIC
SANT 489 553 2.18e0 SMART
low complexity region 627 649 N/A INTRINSIC
ZnF_C2H2 768 790 6.42e-4 SMART
ZnF_C2H2 796 818 7.9e-4 SMART
ZnF_C2H2 824 846 5.99e-4 SMART
ZnF_C2H2 852 874 3.21e-4 SMART
ZnF_C2H2 880 902 1.18e-2 SMART
ZnF_C2H2 908 930 8.81e-2 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000128217
AA Change: W150R

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000134381
Gene: ENSMUSG00000030757
AA Change: W150R

DomainStartEndE-ValueType
SCAN 41 148 1.62e-54 SMART
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931408C20Rik T C 1: 26,683,186 K971R probably benign Het
Ankra2 A G 13: 98,266,234 probably benign Het
Atp9b T A 18: 80,753,149 probably null Het
Birc6 G A 17: 74,639,934 D2885N probably damaging Het
Chaf1b A T 16: 93,888,089 N142I possibly damaging Het
Ckap5 G A 2: 91,576,214 G787S probably damaging Het
Ctc1 G T 11: 69,029,726 C372F possibly damaging Het
Dip2b A G 15: 100,209,636 T1176A probably benign Het
Epha10 A G 4: 124,885,757 E132G probably damaging Het
Extl1 A G 4: 134,359,834 V471A probably benign Het
Fgd6 T C 10: 94,044,355 L357P probably benign Het
Gapvd1 A T 2: 34,728,537 C275S probably damaging Het
Kcnj2 G A 11: 111,072,850 C356Y probably damaging Het
Kcnk10 T C 12: 98,489,960 D204G probably damaging Het
Krtap9-1 A C 11: 99,873,753 E105A unknown Het
Loxhd1 G A 18: 77,405,946 V668I probably benign Het
Ly86 T C 13: 37,375,011 I62T possibly damaging Het
Maip1 A G 1: 57,411,732 I178V probably benign Het
Mical3 G A 6: 121,034,080 Q386* probably null Het
Olfr1057 G A 2: 86,374,797 T205I probably benign Het
Olfr1461 T A 19: 13,165,248 V78D probably damaging Het
Olfr235 T C 19: 12,269,168 *313Q probably null Het
Olfr472 A C 7: 107,903,238 I174L probably benign Het
Pcdha12 T C 18: 37,021,523 S432P probably damaging Het
Prex1 A T 2: 166,713,544 Y59N probably benign Het
Sbf1 A G 15: 89,303,481 F654L probably damaging Het
Sh2d5 T A 4: 138,257,255 Y187* probably null Het
Slc9a4 T C 1: 40,601,035 probably null Het
Smyd2 A G 1: 189,897,426 S136P probably damaging Het
Srsf11 A T 3: 158,022,923 L115* probably null Het
Tbx19 C T 1: 165,153,584 V114I possibly damaging Het
Unc5b A G 10: 60,774,403 V545A probably benign Het
Ush2a A G 1: 188,910,801 Y4120C probably damaging Het
Vps13a T C 19: 16,640,039 T3002A probably damaging Het
Other mutations in Zkscan2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00743:Zkscan2 APN 7 123479972 missense probably damaging 1.00
IGL02098:Zkscan2 APN 7 123499841 missense probably benign 0.02
IGL03093:Zkscan2 APN 7 123494850 missense probably benign 0.01
R0016:Zkscan2 UTSW 7 123499996 start gained probably benign
R0135:Zkscan2 UTSW 7 123480641 missense possibly damaging 0.63
R0541:Zkscan2 UTSW 7 123480200 missense possibly damaging 0.92
R0569:Zkscan2 UTSW 7 123498675 missense probably benign 0.11
R1537:Zkscan2 UTSW 7 123499841 missense possibly damaging 0.95
R1726:Zkscan2 UTSW 7 123489823 missense probably damaging 1.00
R3792:Zkscan2 UTSW 7 123485002 missense possibly damaging 0.95
R3802:Zkscan2 UTSW 7 123495142 intron probably benign
R3803:Zkscan2 UTSW 7 123495142 intron probably benign
R3804:Zkscan2 UTSW 7 123495142 intron probably benign
R4012:Zkscan2 UTSW 7 123498660 missense possibly damaging 0.76
R4111:Zkscan2 UTSW 7 123482684 intron probably benign
R4978:Zkscan2 UTSW 7 123495319 missense possibly damaging 0.86
R5004:Zkscan2 UTSW 7 123490044 missense probably damaging 1.00
R5163:Zkscan2 UTSW 7 123499867 missense probably benign 0.01
R5753:Zkscan2 UTSW 7 123480700 missense probably benign
R5830:Zkscan2 UTSW 7 123480100 missense possibly damaging 0.47
R6153:Zkscan2 UTSW 7 123489770 missense probably benign 0.06
R6912:Zkscan2 UTSW 7 123499973 start gained probably benign
R7170:Zkscan2 UTSW 7 123499807 missense possibly damaging 0.83
R7269:Zkscan2 UTSW 7 123489771 missense probably benign
R7310:Zkscan2 UTSW 7 123490053 missense possibly damaging 0.53
R7399:Zkscan2 UTSW 7 123480104 missense probably damaging 0.98
R7624:Zkscan2 UTSW 7 123498771 missense probably damaging 0.97
R7687:Zkscan2 UTSW 7 123499862 missense probably benign 0.13
Predicted Primers PCR Primer
(F):5'- CTCTACTGAGTGAGCCATAGTG -3'
(R):5'- TTCCCAAATGACTGTGAGCC -3'

Sequencing Primer
(F):5'- GGATACAGTATAAACTACACGGTCTC -3'
(R):5'- AAATGACTGTGAGCCCGCTTC -3'
Posted On2015-09-25