Mutagenetix > Incidental Mutations

Incidental Mutation 'R4605:Fgd6'

345970

Institutional Source

Beutler Lab

Gene Symbol

Fgd6

Ensembl Gene

ENSMUSG00000020021

Gene Name

FYVE, RhoGEF and PH domain containing 6

Synonyms

Etohd4, ZFYVE24

Accession Numbers

Is this an essential gene?

Possibly non essential (E-score: 0.491) question?

Stock #

R4605 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

94036001-94145339 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 94044355 bp

Zygosity

Heterozygous

Amino Acid Change

Leucine to Proline at position 357 (L357P)

Ref Sequence

ENSEMBL: ENSMUSP00000020208 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000020208]

PDB Structure

Solution Structure of the Pleckstrin Homology Domain of Mouse Ethanol Decreased 4 Protein [SOLUTION NMR]

Predicted Effect

probably benign
Transcript: ENSMUST00000020208
AA Change: L357P

PolyPhen 2 Score 0.121 (Sensitivity: 0.93; Specificity: 0.86)

SMART Domains

Protein: ENSMUSP00000020208
Gene: ENSMUSG00000020021
AA Change: L357P

Domain	Start	End	E-Value	Type
low complexity region	4	18	N/A	INTRINSIC
low complexity region	24	34	N/A	INTRINSIC
low complexity region	45	60	N/A	INTRINSIC
low complexity region	75	88	N/A	INTRINSIC
low complexity region	150	161	N/A	INTRINSIC
low complexity region	403	418	N/A	INTRINSIC
low complexity region	803	821	N/A	INTRINSIC
RhoGEF	845	1029	3.09e-46	SMART
PH	1060	1155	6.25e-15	SMART
FYVE	1183	1251	6.93e-28	SMART
low complexity region	1268	1282	N/A	INTRINSIC
PH	1303	1398	1.54e-5	SMART

Coding Region Coverage

1x: 99.3%
3x: 98.6%
10x: 97.2%
20x: 95.1%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 34 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4931408C20Rik	T	C	1: 26,683,186	K971R	probably benign	Het
Ankra2	A	G	13: 98,266,234		probably benign	Het
Atp9b	T	A	18: 80,753,149		probably null	Het
Birc6	G	A	17: 74,639,934	D2885N	probably damaging	Het
Chaf1b	A	T	16: 93,888,089	N142I	possibly damaging	Het
Ckap5	G	A	2: 91,576,214	G787S	probably damaging	Het
Ctc1	G	T	11: 69,029,726	C372F	possibly damaging	Het
Dip2b	A	G	15: 100,209,636	T1176A	probably benign	Het
Epha10	A	G	4: 124,885,757	E132G	probably damaging	Het
Extl1	A	G	4: 134,359,834	V471A	probably benign	Het
Gapvd1	A	T	2: 34,728,537	C275S	probably damaging	Het
Kcnj2	G	A	11: 111,072,850	C356Y	probably damaging	Het
Kcnk10	T	C	12: 98,489,960	D204G	probably damaging	Het
Krtap9-1	A	C	11: 99,873,753	E105A	unknown	Het
Loxhd1	G	A	18: 77,405,946	V668I	probably benign	Het
Ly86	T	C	13: 37,375,011	I62T	possibly damaging	Het
Maip1	A	G	1: 57,411,732	I178V	probably benign	Het
Mical3	G	A	6: 121,034,080	Q386*	probably null	Het
Olfr1057	G	A	2: 86,374,797	T205I	probably benign	Het
Olfr1461	T	A	19: 13,165,248	V78D	probably damaging	Het
Olfr235	T	C	19: 12,269,168	*313Q	probably null	Het
Olfr472	A	C	7: 107,903,238	I174L	probably benign	Het
Pcdha12	T	C	18: 37,021,523	S432P	probably damaging	Het
Prex1	A	T	2: 166,713,544	Y59N	probably benign	Het
Sbf1	A	G	15: 89,303,481	F654L	probably damaging	Het
Sh2d5	T	A	4: 138,257,255	Y187*	probably null	Het
Slc9a4	T	C	1: 40,601,035		probably null	Het
Smyd2	A	G	1: 189,897,426	S136P	probably damaging	Het
Srsf11	A	T	3: 158,022,923	L115*	probably null	Het
Tbx19	C	T	1: 165,153,584	V114I	possibly damaging	Het
Unc5b	A	G	10: 60,774,403	V545A	probably benign	Het
Ush2a	A	G	1: 188,910,801	Y4120C	probably damaging	Het
Vps13a	T	C	19: 16,640,039	T3002A	probably damaging	Het
Zkscan2	A	T	7: 123,498,724	W150R	probably damaging	Het

Other mutations in Fgd6

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00764:Fgd6	APN	10	94043634	missense	probably benign	0.01
IGL00975:Fgd6	APN	10	94134076	missense	probably damaging	0.98
IGL01366:Fgd6	APN	10	94043476	missense	possibly damaging	0.71
IGL01940:Fgd6	APN	10	94089650	splice site	probably null
IGL01958:Fgd6	APN	10	94138308	missense	probably benign	0.25
IGL01988:Fgd6	APN	10	94074335	splice site	probably benign
IGL02019:Fgd6	APN	10	94133354	missense	probably damaging	1.00
IGL02074:Fgd6	APN	10	94127435	missense	probably damaging	1.00
IGL02227:Fgd6	APN	10	94134084	missense	probably damaging	1.00
IGL02262:Fgd6	APN	10	94125628	missense	probably damaging	0.98
IGL02353:Fgd6	APN	10	94138396	missense	possibly damaging	0.82
IGL02360:Fgd6	APN	10	94138396	missense	possibly damaging	0.82
IGL02425:Fgd6	APN	10	94074202	missense	probably benign	0.00
IGL02526:Fgd6	APN	10	94100511	missense	probably benign	0.21
IGL02607:Fgd6	APN	10	94044448	missense	possibly damaging	0.94
IGL02741:Fgd6	APN	10	94123290	missense	possibly damaging	0.65
IGL02870:Fgd6	APN	10	94045164	missense	probably damaging	1.00
IGL02884:Fgd6	APN	10	94045639	splice site	probably benign
IGL02995:Fgd6	APN	10	94045480	nonsense	probably null
IGL03189:Fgd6	APN	10	94044456	missense	probably benign	0.26
IGL03258:Fgd6	APN	10	94133353	missense	probably benign	0.44
IGL03396:Fgd6	APN	10	94044456	missense	probably benign	0.26
FR4449:Fgd6	UTSW	10	94044320	small deletion	probably benign
R0257:Fgd6	UTSW	10	94043915	missense	probably benign	0.11
R0926:Fgd6	UTSW	10	94135047	missense	probably benign	0.40
R1325:Fgd6	UTSW	10	94127427	missense	probably damaging	1.00
R1422:Fgd6	UTSW	10	94045372	missense	probably damaging	1.00
R1491:Fgd6	UTSW	10	94044832	missense	probably benign	0.06
R1593:Fgd6	UTSW	10	94045032	missense	probably damaging	1.00
R1624:Fgd6	UTSW	10	94137436	missense	probably benign	0.19
R1929:Fgd6	UTSW	10	94045006	missense	probably benign	0.01
R2064:Fgd6	UTSW	10	94045041	missense	probably damaging	0.98
R2965:Fgd6	UTSW	10	94044194	missense	probably benign	0.03
R2966:Fgd6	UTSW	10	94044194	missense	probably benign	0.03
R3889:Fgd6	UTSW	10	94089637	missense	probably damaging	1.00
R4094:Fgd6	UTSW	10	94043434	missense	probably damaging	1.00
R4883:Fgd6	UTSW	10	94139853	missense	probably benign	0.00
R5217:Fgd6	UTSW	10	94134077	missense	possibly damaging	0.90
R5473:Fgd6	UTSW	10	94044676	missense	probably benign	0.00
R5606:Fgd6	UTSW	10	94138328	nonsense	probably null
R5644:Fgd6	UTSW	10	94134050	missense	possibly damaging	0.80
R6051:Fgd6	UTSW	10	94137565	critical splice donor site	probably null
R6258:Fgd6	UTSW	10	94044299	missense	probably benign	0.00
R6735:Fgd6	UTSW	10	94074320	missense	possibly damaging	0.94
R7181:Fgd6	UTSW	10	94043511	missense	probably benign	0.02
R7210:Fgd6	UTSW	10	94134092	missense	probably damaging	0.98
R7296:Fgd6	UTSW	10	94044047	nonsense	probably null
R7296:Fgd6	UTSW	10	94139881	missense	probably benign	0.02
R7697:Fgd6	UTSW	10	94045444	missense	probably damaging	0.99
R7747:Fgd6	UTSW	10	94044916	missense	probably damaging	1.00
R7861:Fgd6	UTSW	10	94103331	missense	probably benign	0.15
R7944:Fgd6	UTSW	10	94103331	missense	probably benign	0.15
R8022:Fgd6	UTSW	10	94044344	missense	possibly damaging	0.54
RF031:Fgd6	UTSW	10	94044325	frame shift	probably null
RF040:Fgd6	UTSW	10	94044325	frame shift	probably null

Predicted Primers

PCR Primer
(F):5'- ACAGAGGTCAAAGGTCTCGG -3'
(R):5'- AACCACTGCTGTCAGAAGTC -3'

Sequencing Primer
(F):5'- AAGGTCTCGGTCCTTTAGAAATCCAC -3'
(R):5'- ACTGCTGTCAGAAGTCAAACTAG -3'

Posted On

2015-09-25