Incidental Mutation 'R4605:Ctc1'
List |< first << previous [record 7 of 35] next >> last >|
ID345971
Institutional Source Beutler Lab
Gene Symbol Ctc1
Ensembl Gene ENSMUSG00000020898
Gene NameCTS telomere maintenance complex component 1
Synonyms
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4605 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location69015911-69036473 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 69029726 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Phenylalanine at position 372 (C372F)
Ref Sequence ENSEMBL: ENSMUSP00000124702 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021278] [ENSMUST00000116359] [ENSMUST00000152979] [ENSMUST00000161455]
Predicted Effect possibly damaging
Transcript: ENSMUST00000021278
AA Change: C618F

PolyPhen 2 Score 0.768 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000021278
Gene: ENSMUSG00000020898
AA Change: C618F

DomainStartEndE-ValueType
Pfam:CTC1 60 1195 N/A PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000116359
AA Change: C618F

PolyPhen 2 Score 0.768 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000112063
Gene: ENSMUSG00000020898
AA Change: C618F

DomainStartEndE-ValueType
Pfam:CTC1 61 1196 N/A PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123871
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135611
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143404
Predicted Effect probably benign
Transcript: ENSMUST00000152979
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154126
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161384
Predicted Effect possibly damaging
Transcript: ENSMUST00000161455
AA Change: C372F

PolyPhen 2 Score 0.856 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000124702
Gene: ENSMUSG00000020898
AA Change: C372F

DomainStartEndE-ValueType
Pfam:CTC1 1 949 N/A PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162256
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a component of the CST complex. This complex plays an essential role in protecting telomeres from degradation. This protein also forms a heterodimer with the CST complex subunit STN1 to form the enzyme alpha accessory factor. This enzyme regulates DNA replication. Mutations in this gene are the cause of cerebroretinal microangiopathy with calcifications and cysts. Alternate splicing results in both coding and non-coding variants. [provided by RefSeq, Mar 2012]
PHENOTYPE: Mice homozygous for a targeted allele exhibit defective telomere replication that leads to stem cell exhaustion, bone marrow failure and premature death. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931408C20Rik T C 1: 26,683,186 K971R probably benign Het
Ankra2 A G 13: 98,266,234 probably benign Het
Atp9b T A 18: 80,753,149 probably null Het
Birc6 G A 17: 74,639,934 D2885N probably damaging Het
Chaf1b A T 16: 93,888,089 N142I possibly damaging Het
Ckap5 G A 2: 91,576,214 G787S probably damaging Het
Dip2b A G 15: 100,209,636 T1176A probably benign Het
Epha10 A G 4: 124,885,757 E132G probably damaging Het
Extl1 A G 4: 134,359,834 V471A probably benign Het
Fgd6 T C 10: 94,044,355 L357P probably benign Het
Gapvd1 A T 2: 34,728,537 C275S probably damaging Het
Kcnj2 G A 11: 111,072,850 C356Y probably damaging Het
Kcnk10 T C 12: 98,489,960 D204G probably damaging Het
Krtap9-1 A C 11: 99,873,753 E105A unknown Het
Loxhd1 G A 18: 77,405,946 V668I probably benign Het
Ly86 T C 13: 37,375,011 I62T possibly damaging Het
Maip1 A G 1: 57,411,732 I178V probably benign Het
Mical3 G A 6: 121,034,080 Q386* probably null Het
Olfr1057 G A 2: 86,374,797 T205I probably benign Het
Olfr1461 T A 19: 13,165,248 V78D probably damaging Het
Olfr235 T C 19: 12,269,168 *313Q probably null Het
Olfr472 A C 7: 107,903,238 I174L probably benign Het
Pcdha12 T C 18: 37,021,523 S432P probably damaging Het
Prex1 A T 2: 166,713,544 Y59N probably benign Het
Sbf1 A G 15: 89,303,481 F654L probably damaging Het
Sh2d5 T A 4: 138,257,255 Y187* probably null Het
Slc9a4 T C 1: 40,601,035 probably null Het
Smyd2 A G 1: 189,897,426 S136P probably damaging Het
Srsf11 A T 3: 158,022,923 L115* probably null Het
Tbx19 C T 1: 165,153,584 V114I possibly damaging Het
Unc5b A G 10: 60,774,403 V545A probably benign Het
Ush2a A G 1: 188,910,801 Y4120C probably damaging Het
Vps13a T C 19: 16,640,039 T3002A probably damaging Het
Zkscan2 A T 7: 123,498,724 W150R probably damaging Het
Other mutations in Ctc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02005:Ctc1 APN 11 69031149 missense probably damaging 1.00
IGL02135:Ctc1 APN 11 69021163 missense probably benign 0.25
IGL02164:Ctc1 APN 11 69026096 missense probably damaging 0.99
IGL02337:Ctc1 APN 11 69026131 missense probably damaging 1.00
IGL03149:Ctc1 APN 11 69031161 missense possibly damaging 0.55
PIT4810001:Ctc1 UTSW 11 69022526 missense probably benign 0.38
R0295:Ctc1 UTSW 11 69030588 missense possibly damaging 0.75
R0320:Ctc1 UTSW 11 69033537 missense probably damaging 1.00
R0496:Ctc1 UTSW 11 69035507 missense probably damaging 1.00
R1497:Ctc1 UTSW 11 69022561 missense probably benign 0.00
R1607:Ctc1 UTSW 11 69036150 missense possibly damaging 0.82
R1623:Ctc1 UTSW 11 69021142 missense probably damaging 0.99
R1856:Ctc1 UTSW 11 69034658 missense probably damaging 1.00
R1876:Ctc1 UTSW 11 69031564 missense probably benign 0.24
R1967:Ctc1 UTSW 11 69027862 critical splice acceptor site probably null
R2164:Ctc1 UTSW 11 69035615 missense possibly damaging 0.92
R2348:Ctc1 UTSW 11 69026191 missense probably benign 0.43
R2428:Ctc1 UTSW 11 69027701 missense possibly damaging 0.51
R3964:Ctc1 UTSW 11 69031128 missense probably damaging 1.00
R3965:Ctc1 UTSW 11 69031128 missense probably damaging 1.00
R3966:Ctc1 UTSW 11 69031128 missense probably damaging 1.00
R4398:Ctc1 UTSW 11 69022871 missense probably damaging 1.00
R4508:Ctc1 UTSW 11 69016117 splice site probably null
R4976:Ctc1 UTSW 11 69027326 missense probably damaging 1.00
R4979:Ctc1 UTSW 11 69033502 missense probably damaging 1.00
R5268:Ctc1 UTSW 11 69029810 missense possibly damaging 0.67
R6023:Ctc1 UTSW 11 69022607 missense probably benign 0.00
R6053:Ctc1 UTSW 11 69027901 missense probably benign 0.01
R7204:Ctc1 UTSW 11 69029741 missense probably damaging 1.00
R7252:Ctc1 UTSW 11 69026174 missense probably damaging 1.00
R7357:Ctc1 UTSW 11 69034742 missense probably benign 0.17
R7654:Ctc1 UTSW 11 69026215 missense probably damaging 1.00
R7724:Ctc1 UTSW 11 69026344 missense probably benign 0.00
R7890:Ctc1 UTSW 11 69026529 missense probably damaging 1.00
R7973:Ctc1 UTSW 11 69026529 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTACACGTGTGAGTGCTTGC -3'
(R):5'- CATTAAGGAAGCCCAGCAGG -3'

Sequencing Primer
(F):5'- CTAGCTGGCCTGGAACTCATAATG -3'
(R):5'- AGGCGCTCCCTCTCTCAC -3'
Posted On2015-09-25