Incidental Mutation 'R4605:Kcnj2'
ID345973
Institutional Source Beutler Lab
Gene Symbol Kcnj2
Ensembl Gene ENSMUSG00000041695
Gene Namepotassium inwardly-rectifying channel, subfamily J, member 2
SynonymsIRK1, Kcnf1, Kir2.1
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4605 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location111066164-111076821 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 111072850 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Tyrosine at position 356 (C356Y)
Ref Sequence ENSEMBL: ENSMUSP00000037192 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042970]
PDB Structure
Crystal Structure of Cytoplasmic Domains of IRK1 (Kir2.1) channel [X-RAY DIFFRACTION]
Cytoplasmic Domain Structure of Kir2.1 containing Andersen's Mutation R218Q and Rescue Mutation T309K [X-RAY DIFFRACTION]
Single particle analysis of Kir2.1NC_4 in negative stain [SOLUTION SCATTERING, ELECTRON MICROSCOPY]
Predicted Effect probably damaging
Transcript: ENSMUST00000042970
AA Change: C356Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000037192
Gene: ENSMUSG00000041695
AA Change: C356Y

DomainStartEndE-ValueType
Pfam:IRK_N 1 47 2.9e-29 PFAM
Pfam:IRK 48 373 7.3e-158 PFAM
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Potassium channels are present in most mammalian cells, where they participate in a wide range of physiologic responses. The protein encoded by this gene is an integral membrane protein and inward-rectifier type potassium channel. The encoded protein, which has a greater tendency to allow potassium to flow into a cell rather than out of a cell, probably participates in establishing action potential waveform and excitability of neuronal and muscle tissues. Mutations in this gene have been associated with Andersen syndrome, which is characterized by periodic paralysis, cardiac arrhythmias, and dysmorphic features. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a targeted null mutation die within 8-12 hours after birth, displaying cyanosis and respiratory distress, as well as complete cleft of the secondary palate, and loss of K+-mediated vasodilatation in cerebral arteries. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931408C20Rik T C 1: 26,683,186 K971R probably benign Het
Ankra2 A G 13: 98,266,234 probably benign Het
Atp9b T A 18: 80,753,149 probably null Het
Birc6 G A 17: 74,639,934 D2885N probably damaging Het
Chaf1b A T 16: 93,888,089 N142I possibly damaging Het
Ckap5 G A 2: 91,576,214 G787S probably damaging Het
Ctc1 G T 11: 69,029,726 C372F possibly damaging Het
Dip2b A G 15: 100,209,636 T1176A probably benign Het
Epha10 A G 4: 124,885,757 E132G probably damaging Het
Extl1 A G 4: 134,359,834 V471A probably benign Het
Fgd6 T C 10: 94,044,355 L357P probably benign Het
Gapvd1 A T 2: 34,728,537 C275S probably damaging Het
Kcnk10 T C 12: 98,489,960 D204G probably damaging Het
Krtap9-1 A C 11: 99,873,753 E105A unknown Het
Loxhd1 G A 18: 77,405,946 V668I probably benign Het
Ly86 T C 13: 37,375,011 I62T possibly damaging Het
Maip1 A G 1: 57,411,732 I178V probably benign Het
Mical3 G A 6: 121,034,080 Q386* probably null Het
Olfr1057 G A 2: 86,374,797 T205I probably benign Het
Olfr1461 T A 19: 13,165,248 V78D probably damaging Het
Olfr235 T C 19: 12,269,168 *313Q probably null Het
Olfr472 A C 7: 107,903,238 I174L probably benign Het
Pcdha12 T C 18: 37,021,523 S432P probably damaging Het
Prex1 A T 2: 166,713,544 Y59N probably benign Het
Sbf1 A G 15: 89,303,481 F654L probably damaging Het
Sh2d5 T A 4: 138,257,255 Y187* probably null Het
Slc9a4 T C 1: 40,601,035 probably null Het
Smyd2 A G 1: 189,897,426 S136P probably damaging Het
Srsf11 A T 3: 158,022,923 L115* probably null Het
Tbx19 C T 1: 165,153,584 V114I possibly damaging Het
Unc5b A G 10: 60,774,403 V545A probably benign Het
Ush2a A G 1: 188,910,801 Y4120C probably damaging Het
Vps13a T C 19: 16,640,039 T3002A probably damaging Het
Zkscan2 A T 7: 123,498,724 W150R probably damaging Het
Other mutations in Kcnj2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00566:Kcnj2 APN 11 111071827 missense probably damaging 1.00
IGL02448:Kcnj2 APN 11 111072282 missense probably benign 0.00
R0090:Kcnj2 UTSW 11 111073027 missense probably benign 0.02
R1162:Kcnj2 UTSW 11 111072967 missense probably benign
R1990:Kcnj2 UTSW 11 111072883 missense probably benign 0.00
R3948:Kcnj2 UTSW 11 111072655 missense possibly damaging 0.73
R4417:Kcnj2 UTSW 11 111072189 missense probably damaging 1.00
R5191:Kcnj2 UTSW 11 111072471 nonsense probably null
R5439:Kcnj2 UTSW 11 111072231 missense probably damaging 1.00
R5530:Kcnj2 UTSW 11 111072091 missense probably damaging 1.00
R6167:Kcnj2 UTSW 11 111072489 missense probably benign
R7126:Kcnj2 UTSW 11 111072822 missense probably damaging 1.00
R7713:Kcnj2 UTSW 11 111072483 missense probably benign 0.00
R8007:Kcnj2 UTSW 11 111073058 missense probably benign 0.24
X0052:Kcnj2 UTSW 11 111071856 missense probably benign 0.13
Z1176:Kcnj2 UTSW 11 111072135 missense probably benign
Predicted Primers PCR Primer
(F):5'- TGTCATACTGGAAGGCATGGTG -3'
(R):5'- ATATCTCCGATTCTCGCCTTAAGG -3'

Sequencing Primer
(F):5'- CATGGTGGAGGCGACTG -3'
(R):5'- CTCTAGAGGTACGCTTGCCTG -3'
Posted On2015-09-25