Incidental Mutation 'R4605:Kcnk10'
List |< first << previous [record 14 of 35] next >> last >|
ID345974
Institutional Source Beutler Lab
Gene Symbol Kcnk10
Ensembl Gene ENSMUSG00000033854
Gene Namepotassium channel, subfamily K, member 10
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.077) question?
Stock #R4605 (G1)
Quality Score225
Status Not validated
Chromosome12
Chromosomal Location98429437-98578310 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 98489960 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 204 (D204G)
Ref Sequence ENSEMBL: ENSMUSP00000152656 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000110113] [ENSMUST00000221240] [ENSMUST00000221305]
Predicted Effect probably damaging
Transcript: ENSMUST00000110113
AA Change: D187G

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000105740
Gene: ENSMUSG00000033854
AA Change: D187G

DomainStartEndE-ValueType
signal peptide 1 16 N/A INTRINSIC
Pfam:Ion_trans 55 207 9.3e-8 PFAM
Pfam:Ion_trans_2 126 204 3.3e-20 PFAM
Pfam:Ion_trans_2 223 321 8.5e-21 PFAM
low complexity region 449 462 N/A INTRINSIC
low complexity region 479 489 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000221240
AA Change: D201G

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
Predicted Effect probably damaging
Transcript: ENSMUST00000221305
AA Change: D204G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000221906
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the family of potassium channel proteins containing two pore-forming P domains. This channel is an open rectifier which primarily passes outward current under physiological K+ concentrations, and is stimulated strongly by arachidonic acid and to a lesser degree by membrane stretching, intracellular acidification, and general anaesthetics. Several alternatively spliced transcript variants encoding different isoforms have been identified for this gene. [provided by RefSeq, Sep 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit normal glucose hyperpolarization of hypothalamic neurons in response to glucose. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931408C20Rik T C 1: 26,683,186 K971R probably benign Het
Ankra2 A G 13: 98,266,234 probably benign Het
Atp9b T A 18: 80,753,149 probably null Het
Birc6 G A 17: 74,639,934 D2885N probably damaging Het
Chaf1b A T 16: 93,888,089 N142I possibly damaging Het
Ckap5 G A 2: 91,576,214 G787S probably damaging Het
Ctc1 G T 11: 69,029,726 C372F possibly damaging Het
Dip2b A G 15: 100,209,636 T1176A probably benign Het
Epha10 A G 4: 124,885,757 E132G probably damaging Het
Extl1 A G 4: 134,359,834 V471A probably benign Het
Fgd6 T C 10: 94,044,355 L357P probably benign Het
Gapvd1 A T 2: 34,728,537 C275S probably damaging Het
Kcnj2 G A 11: 111,072,850 C356Y probably damaging Het
Krtap9-1 A C 11: 99,873,753 E105A unknown Het
Loxhd1 G A 18: 77,405,946 V668I probably benign Het
Ly86 T C 13: 37,375,011 I62T possibly damaging Het
Maip1 A G 1: 57,411,732 I178V probably benign Het
Mical3 G A 6: 121,034,080 Q386* probably null Het
Olfr1057 G A 2: 86,374,797 T205I probably benign Het
Olfr1461 T A 19: 13,165,248 V78D probably damaging Het
Olfr235 T C 19: 12,269,168 *313Q probably null Het
Olfr472 A C 7: 107,903,238 I174L probably benign Het
Pcdha12 T C 18: 37,021,523 S432P probably damaging Het
Prex1 A T 2: 166,713,544 Y59N probably benign Het
Sbf1 A G 15: 89,303,481 F654L probably damaging Het
Sh2d5 T A 4: 138,257,255 Y187* probably null Het
Slc9a4 T C 1: 40,601,035 probably null Het
Smyd2 A G 1: 189,897,426 S136P probably damaging Het
Srsf11 A T 3: 158,022,923 L115* probably null Het
Tbx19 C T 1: 165,153,584 V114I possibly damaging Het
Unc5b A G 10: 60,774,403 V545A probably benign Het
Ush2a A G 1: 188,910,801 Y4120C probably damaging Het
Vps13a T C 19: 16,640,039 T3002A probably damaging Het
Zkscan2 A T 7: 123,498,724 W150R probably damaging Het
Other mutations in Kcnk10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00977:Kcnk10 APN 12 98518533 missense probably damaging 0.99
IGL01409:Kcnk10 APN 12 98490063 missense probably damaging 1.00
IGL02149:Kcnk10 APN 12 98518840 splice site probably benign
R0467:Kcnk10 UTSW 12 98489945 missense probably benign 0.43
R0558:Kcnk10 UTSW 12 98436301 missense possibly damaging 0.89
R0665:Kcnk10 UTSW 12 98440685 missense probably benign 0.00
R1033:Kcnk10 UTSW 12 98518670 missense possibly damaging 0.93
R1036:Kcnk10 UTSW 12 98496186 splice site probably benign
R1398:Kcnk10 UTSW 12 98436226 missense probably damaging 0.99
R1482:Kcnk10 UTSW 12 98489948 missense probably damaging 0.99
R1675:Kcnk10 UTSW 12 98496288 missense probably benign 0.31
R2858:Kcnk10 UTSW 12 98435289 missense possibly damaging 0.64
R2871:Kcnk10 UTSW 12 98434813 missense probably benign 0.41
R2871:Kcnk10 UTSW 12 98434813 missense probably benign 0.41
R3736:Kcnk10 UTSW 12 98489912 missense probably benign 0.31
R3845:Kcnk10 UTSW 12 98440744 missense probably benign 0.11
R4077:Kcnk10 UTSW 12 98434946 missense probably benign 0.03
R4541:Kcnk10 UTSW 12 98436277 missense probably damaging 1.00
R4841:Kcnk10 UTSW 12 98434916 missense probably benign 0.00
R4842:Kcnk10 UTSW 12 98434916 missense probably benign 0.00
R4886:Kcnk10 UTSW 12 98435159 missense possibly damaging 0.89
R4968:Kcnk10 UTSW 12 98434902 missense probably benign 0.01
R4977:Kcnk10 UTSW 12 98440687 missense probably benign 0.07
R5108:Kcnk10 UTSW 12 98435301 missense probably benign 0.39
R5166:Kcnk10 UTSW 12 98434995 missense probably damaging 0.98
R5936:Kcnk10 UTSW 12 98489932 missense probably benign 0.12
R6193:Kcnk10 UTSW 12 98440772 missense probably benign 0.07
R7107:Kcnk10 UTSW 12 98518743 nonsense probably null
R7611:Kcnk10 UTSW 12 98518640 missense probably damaging 1.00
R7687:Kcnk10 UTSW 12 98435096 missense probably damaging 0.97
X0067:Kcnk10 UTSW 12 98518824 missense possibly damaging 0.88
Predicted Primers PCR Primer
(F):5'- CGATGTTTAGACAAAGTCCTCTG -3'
(R):5'- GTGGATTCTTTGGTCAATGCTCTAC -3'

Sequencing Primer
(F):5'- ATGTTTAGACAAAGTCCTCTGTCCAC -3'
(R):5'- TGGTCAATGCTCTACTTTCTCC -3'
Posted On2015-09-25