Incidental Mutation 'R4605:Chaf1b'
ID345979
Institutional Source Beutler Lab
Gene Symbol Chaf1b
Ensembl Gene ENSMUSG00000022945
Gene Namechromatin assembly factor 1, subunit B (p60)
Synonyms2600017H24Rik, CAF1P60, CAF1A, MPHOSPH7, CAF1, CAF-I 60 kDa subunit, CAF-IP60, CAF-1 subunit B
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.946) question?
Stock #R4605 (G1)
Quality Score218
Status Not validated
Chromosome16
Chromosomal Location93883901-93906115 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 93888089 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Isoleucine at position 142 (N142I)
Ref Sequence ENSEMBL: ENSMUSP00000113684 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023666] [ENSMUST00000117099] [ENSMUST00000120586] [ENSMUST00000142316] [ENSMUST00000143006]
Predicted Effect possibly damaging
Transcript: ENSMUST00000023666
AA Change: N142I

PolyPhen 2 Score 0.896 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000023666
Gene: ENSMUSG00000022945
AA Change: N142I

DomainStartEndE-ValueType
WD40 3 45 4.95e0 SMART
WD40 55 94 4.44e-6 SMART
WD40 118 157 3.78e-9 SMART
WD40 160 199 5.86e-6 SMART
Blast:WD40 219 258 5e-10 BLAST
WD40 274 338 2.84e2 SMART
WD40 344 381 5.13e0 SMART
Pfam:CAF-1_p60_C 388 564 2e-75 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000117099
AA Change: N142I

PolyPhen 2 Score 0.896 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000113684
Gene: ENSMUSG00000022945
AA Change: N142I

DomainStartEndE-ValueType
WD40 3 45 4.95e0 SMART
WD40 55 94 4.44e-6 SMART
WD40 118 157 3.78e-9 SMART
WD40 160 199 5.86e-6 SMART
Blast:WD40 219 258 5e-10 BLAST
WD40 274 338 2.84e2 SMART
WD40 344 381 5.13e0 SMART
Pfam:CAF-1_p60_C 388 561 6.3e-69 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000120586
SMART Domains Protein: ENSMUSP00000113420
Gene: ENSMUSG00000022945

DomainStartEndE-ValueType
WD40 3 45 4.95e0 SMART
WD40 55 94 4.44e-6 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124313
Predicted Effect probably benign
Transcript: ENSMUST00000142316
SMART Domains Protein: ENSMUSP00000121034
Gene: ENSMUSG00000022945

DomainStartEndE-ValueType
Pfam:WD40 8 45 3.5e-4 PFAM
Blast:WD40 55 79 2e-9 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000143006
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152980
Predicted Effect noncoding transcript
Transcript: ENSMUST00000232065
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Chromatin assembly factor I (CAF-I) is required for the assembly of histone octamers onto newly-replicated DNA. CAF-I is composed of three protein subunits, p50, p60, and p150. The protein encoded by this gene corresponds to the p60 subunit and is required for chromatin assembly after replication. The encoded protein is differentially phosphorylated in a cell cycle-dependent manner. In addition, it is normally found in the nucleus except during mitosis, when it is released into the cytoplasm. This protein is a member of the WD-repeat HIR1 family and may also be involved in DNA repair. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931408C20Rik T C 1: 26,683,186 K971R probably benign Het
Ankra2 A G 13: 98,266,234 probably benign Het
Atp9b T A 18: 80,753,149 probably null Het
Birc6 G A 17: 74,639,934 D2885N probably damaging Het
Ckap5 G A 2: 91,576,214 G787S probably damaging Het
Ctc1 G T 11: 69,029,726 C372F possibly damaging Het
Dip2b A G 15: 100,209,636 T1176A probably benign Het
Epha10 A G 4: 124,885,757 E132G probably damaging Het
Extl1 A G 4: 134,359,834 V471A probably benign Het
Fgd6 T C 10: 94,044,355 L357P probably benign Het
Gapvd1 A T 2: 34,728,537 C275S probably damaging Het
Kcnj2 G A 11: 111,072,850 C356Y probably damaging Het
Kcnk10 T C 12: 98,489,960 D204G probably damaging Het
Krtap9-1 A C 11: 99,873,753 E105A unknown Het
Loxhd1 G A 18: 77,405,946 V668I probably benign Het
Ly86 T C 13: 37,375,011 I62T possibly damaging Het
Maip1 A G 1: 57,411,732 I178V probably benign Het
Mical3 G A 6: 121,034,080 Q386* probably null Het
Olfr1057 G A 2: 86,374,797 T205I probably benign Het
Olfr1461 T A 19: 13,165,248 V78D probably damaging Het
Olfr235 T C 19: 12,269,168 *313Q probably null Het
Olfr472 A C 7: 107,903,238 I174L probably benign Het
Pcdha12 T C 18: 37,021,523 S432P probably damaging Het
Prex1 A T 2: 166,713,544 Y59N probably benign Het
Sbf1 A G 15: 89,303,481 F654L probably damaging Het
Sh2d5 T A 4: 138,257,255 Y187* probably null Het
Slc9a4 T C 1: 40,601,035 probably null Het
Smyd2 A G 1: 189,897,426 S136P probably damaging Het
Srsf11 A T 3: 158,022,923 L115* probably null Het
Tbx19 C T 1: 165,153,584 V114I possibly damaging Het
Unc5b A G 10: 60,774,403 V545A probably benign Het
Ush2a A G 1: 188,910,801 Y4120C probably damaging Het
Vps13a T C 19: 16,640,039 T3002A probably damaging Het
Zkscan2 A T 7: 123,498,724 W150R probably damaging Het
Other mutations in Chaf1b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00562:Chaf1b APN 16 93900191 unclassified probably benign
R0090:Chaf1b UTSW 16 93887124 missense possibly damaging 0.52
R0309:Chaf1b UTSW 16 93884511 missense probably damaging 0.96
R0690:Chaf1b UTSW 16 93900017 splice site probably benign
R1494:Chaf1b UTSW 16 93888110 missense probably damaging 1.00
R1572:Chaf1b UTSW 16 93901230 missense possibly damaging 0.77
R1595:Chaf1b UTSW 16 93905099 critical splice donor site probably null
R1654:Chaf1b UTSW 16 93894903 missense probably damaging 0.97
R2057:Chaf1b UTSW 16 93894907 missense probably damaging 1.00
R2280:Chaf1b UTSW 16 93891571 missense probably damaging 1.00
R2406:Chaf1b UTSW 16 93900155 missense probably damaging 0.99
R2655:Chaf1b UTSW 16 93891511 missense probably damaging 0.99
R4522:Chaf1b UTSW 16 93901295 missense probably benign 0.05
R4686:Chaf1b UTSW 16 93884584 missense probably benign 0.00
R4784:Chaf1b UTSW 16 93884542 missense probably damaging 1.00
R4862:Chaf1b UTSW 16 93887134 missense probably damaging 0.99
R5603:Chaf1b UTSW 16 93892795 missense probably damaging 1.00
R5683:Chaf1b UTSW 16 93887142 missense possibly damaging 0.90
R6763:Chaf1b UTSW 16 93891505 missense probably damaging 1.00
R6940:Chaf1b UTSW 16 93905965 missense probably benign 0.00
R7401:Chaf1b UTSW 16 93884380 start gained probably benign
R7862:Chaf1b UTSW 16 93888095 missense possibly damaging 0.90
R7945:Chaf1b UTSW 16 93888095 missense possibly damaging 0.90
Predicted Primers PCR Primer
(F):5'- AGGGCTGACACATCTCCATG -3'
(R):5'- CGTAGTAGCAGAAATAAACCACTTGG -3'

Sequencing Primer
(F):5'- GAACTCACTCTGTAGACTAGGCTG -3'
(R):5'- CAAGCTTGGTGGTTCCTAGACAAC -3'
Posted On2015-09-25