Incidental Mutation 'R4605:Olfr235'
ID345984
Institutional Source Beutler Lab
Gene Symbol Olfr235
Ensembl Gene ENSMUSG00000060049
Gene Nameolfactory receptor 235
SynonymsMOR214-3, GA_x6K02T03CT6-1-477, Olfr245, GA_x6K02T2LL2P-1028-792, Olfr232, GA_x6K02T057QT-4025-4642, MOR214-3
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.058) question?
Stock #R4605 (G1)
Quality Score225
Status Not validated
Chromosome19
Chromosomal Location12261032-12270387 bp(+) (GRCm38)
Type of Mutationmakesense
DNA Base Change (assembly) T to C at 12269168 bp
ZygosityHeterozygous
Amino Acid Change Stop codon to Glutamine at position 313 (*313Q)
Ref Sequence ENSEMBL: ENSMUSP00000150313 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000073507] [ENSMUST00000207969] [ENSMUST00000214551] [ENSMUST00000214613] [ENSMUST00000214638] [ENSMUST00000215407]
Predicted Effect probably null
Transcript: ENSMUST00000073507
AA Change: *313Q
SMART Domains Protein: ENSMUSP00000073203
Gene: ENSMUSG00000060049
AA Change: *313Q

DomainStartEndE-ValueType
Pfam:7tm_4 32 309 3.8e-56 PFAM
Pfam:7tm_1 42 309 1.2e-17 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000207842
Predicted Effect probably null
Transcript: ENSMUST00000207969
AA Change: *313Q
Predicted Effect probably null
Transcript: ENSMUST00000214551
AA Change: *313Q
Predicted Effect probably null
Transcript: ENSMUST00000214613
AA Change: *313Q
Predicted Effect probably null
Transcript: ENSMUST00000214638
AA Change: *313Q
Predicted Effect probably null
Transcript: ENSMUST00000215407
AA Change: *313Q
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931408C20Rik T C 1: 26,683,186 K971R probably benign Het
Ankra2 A G 13: 98,266,234 probably benign Het
Atp9b T A 18: 80,753,149 probably null Het
Birc6 G A 17: 74,639,934 D2885N probably damaging Het
Chaf1b A T 16: 93,888,089 N142I possibly damaging Het
Ckap5 G A 2: 91,576,214 G787S probably damaging Het
Ctc1 G T 11: 69,029,726 C372F possibly damaging Het
Dip2b A G 15: 100,209,636 T1176A probably benign Het
Epha10 A G 4: 124,885,757 E132G probably damaging Het
Extl1 A G 4: 134,359,834 V471A probably benign Het
Fgd6 T C 10: 94,044,355 L357P probably benign Het
Gapvd1 A T 2: 34,728,537 C275S probably damaging Het
Kcnj2 G A 11: 111,072,850 C356Y probably damaging Het
Kcnk10 T C 12: 98,489,960 D204G probably damaging Het
Krtap9-1 A C 11: 99,873,753 E105A unknown Het
Loxhd1 G A 18: 77,405,946 V668I probably benign Het
Ly86 T C 13: 37,375,011 I62T possibly damaging Het
Maip1 A G 1: 57,411,732 I178V probably benign Het
Mical3 G A 6: 121,034,080 Q386* probably null Het
Olfr1057 G A 2: 86,374,797 T205I probably benign Het
Olfr1461 T A 19: 13,165,248 V78D probably damaging Het
Olfr472 A C 7: 107,903,238 I174L probably benign Het
Pcdha12 T C 18: 37,021,523 S432P probably damaging Het
Prex1 A T 2: 166,713,544 Y59N probably benign Het
Sbf1 A G 15: 89,303,481 F654L probably damaging Het
Sh2d5 T A 4: 138,257,255 Y187* probably null Het
Slc9a4 T C 1: 40,601,035 probably null Het
Smyd2 A G 1: 189,897,426 S136P probably damaging Het
Srsf11 A T 3: 158,022,923 L115* probably null Het
Tbx19 C T 1: 165,153,584 V114I possibly damaging Het
Unc5b A G 10: 60,774,403 V545A probably benign Het
Ush2a A G 1: 188,910,801 Y4120C probably damaging Het
Vps13a T C 19: 16,640,039 T3002A probably damaging Het
Zkscan2 A T 7: 123,498,724 W150R probably damaging Het
Other mutations in Olfr235
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02116:Olfr235 APN 19 12269010 missense probably damaging 1.00
IGL03397:Olfr235 APN 19 12268502 missense probably benign 0.03
R1239:Olfr235 UTSW 19 12268976 missense probably damaging 1.00
R1416:Olfr235 UTSW 19 12268894 missense probably benign 0.09
R1441:Olfr235 UTSW 19 12268386 nonsense probably null
R1694:Olfr235 UTSW 19 12268917 missense probably damaging 1.00
R1727:Olfr235 UTSW 19 12269001 missense possibly damaging 0.70
R2422:Olfr235 UTSW 19 12268919 missense probably damaging 0.99
R3439:Olfr235 UTSW 19 12268395 missense possibly damaging 0.56
R4545:Olfr235 UTSW 19 12268824 missense possibly damaging 0.91
R5147:Olfr235 UTSW 19 12268904 missense probably damaging 1.00
R5382:Olfr235 UTSW 19 12268409 missense possibly damaging 0.62
R5717:Olfr235 UTSW 19 12269156 missense probably benign 0.13
R6455:Olfr235 UTSW 19 12268706 missense probably damaging 0.97
R6880:Olfr235 UTSW 19 12268610 missense probably benign 0.22
R7311:Olfr235 UTSW 19 12268704 missense probably benign 0.29
R7384:Olfr235 UTSW 19 12269076 missense possibly damaging 0.80
Predicted Primers PCR Primer
(F):5'- TGCTTCTCACCTGACAGCTG -3'
(R):5'- GACCCTGCTGTTCTTAAAACTAATG -3'

Sequencing Primer
(F):5'- TGACAGCTGTTTCTCTCTTCTATAG -3'
(R):5'- TGCTGTTCTTAAAACTAATGTGTTTC -3'
Posted On2015-09-25