Incidental Mutation 'R4605:Olfr1461'
ID345985
Institutional Source Beutler Lab
Gene Symbol Olfr1461
Ensembl Gene ENSMUSG00000045883
Gene Nameolfactory receptor 1461
SynonymsGA_x6K02T2RE5P-3491834-3492772, MOR202-35
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.169) question?
Stock #R4605 (G1)
Quality Score225
Status Not validated
Chromosome19
Chromosomal Location13163000-13168130 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 13165248 bp
ZygosityHeterozygous
Amino Acid Change Valine to Aspartic acid at position 78 (V78D)
Ref Sequence ENSEMBL: ENSMUSP00000146723 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053772] [ENSMUST00000207113] [ENSMUST00000208489]
Predicted Effect probably damaging
Transcript: ENSMUST00000053772
AA Change: V78D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000053269
Gene: ENSMUSG00000045883
AA Change: V78D

DomainStartEndE-ValueType
Pfam:7tm_4 32 309 6e-55 PFAM
Pfam:7TM_GPCR_Srsx 36 306 8e-6 PFAM
Pfam:7tm_1 42 291 2e-18 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000207113
AA Change: V78D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000208489
AA Change: V78D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931408C20Rik T C 1: 26,683,186 K971R probably benign Het
Ankra2 A G 13: 98,266,234 probably benign Het
Atp9b T A 18: 80,753,149 probably null Het
Birc6 G A 17: 74,639,934 D2885N probably damaging Het
Chaf1b A T 16: 93,888,089 N142I possibly damaging Het
Ckap5 G A 2: 91,576,214 G787S probably damaging Het
Ctc1 G T 11: 69,029,726 C372F possibly damaging Het
Dip2b A G 15: 100,209,636 T1176A probably benign Het
Epha10 A G 4: 124,885,757 E132G probably damaging Het
Extl1 A G 4: 134,359,834 V471A probably benign Het
Fgd6 T C 10: 94,044,355 L357P probably benign Het
Gapvd1 A T 2: 34,728,537 C275S probably damaging Het
Kcnj2 G A 11: 111,072,850 C356Y probably damaging Het
Kcnk10 T C 12: 98,489,960 D204G probably damaging Het
Krtap9-1 A C 11: 99,873,753 E105A unknown Het
Loxhd1 G A 18: 77,405,946 V668I probably benign Het
Ly86 T C 13: 37,375,011 I62T possibly damaging Het
Maip1 A G 1: 57,411,732 I178V probably benign Het
Mical3 G A 6: 121,034,080 Q386* probably null Het
Olfr1057 G A 2: 86,374,797 T205I probably benign Het
Olfr235 T C 19: 12,269,168 *313Q probably null Het
Olfr472 A C 7: 107,903,238 I174L probably benign Het
Pcdha12 T C 18: 37,021,523 S432P probably damaging Het
Prex1 A T 2: 166,713,544 Y59N probably benign Het
Sbf1 A G 15: 89,303,481 F654L probably damaging Het
Sh2d5 T A 4: 138,257,255 Y187* probably null Het
Slc9a4 T C 1: 40,601,035 probably null Het
Smyd2 A G 1: 189,897,426 S136P probably damaging Het
Srsf11 A T 3: 158,022,923 L115* probably null Het
Tbx19 C T 1: 165,153,584 V114I possibly damaging Het
Unc5b A G 10: 60,774,403 V545A probably benign Het
Ush2a A G 1: 188,910,801 Y4120C probably damaging Het
Vps13a T C 19: 16,640,039 T3002A probably damaging Het
Zkscan2 A T 7: 123,498,724 W150R probably damaging Het
Other mutations in Olfr1461
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01088:Olfr1461 APN 19 13165371 missense probably damaging 1.00
IGL01370:Olfr1461 APN 19 13165299 missense possibly damaging 0.95
IGL01936:Olfr1461 APN 19 13165403 missense probably damaging 1.00
R0098:Olfr1461 UTSW 19 13165662 missense probably benign 0.12
R0270:Olfr1461 UTSW 19 13165887 missense probably damaging 1.00
R0575:Olfr1461 UTSW 19 13165387 nonsense probably null
R0627:Olfr1461 UTSW 19 13165250 missense probably benign 0.43
R1779:Olfr1461 UTSW 19 13165040 missense probably benign 0.00
R1956:Olfr1461 UTSW 19 13165196 missense probably damaging 1.00
R2446:Olfr1461 UTSW 19 13165447 missense probably benign 0.00
R3622:Olfr1461 UTSW 19 13165656 missense probably benign 0.06
R4485:Olfr1461 UTSW 19 13165491 missense possibly damaging 0.54
R4757:Olfr1461 UTSW 19 13165913 missense probably benign 0.01
R4816:Olfr1461 UTSW 19 13165124 missense probably benign 0.10
R5038:Olfr1461 UTSW 19 13165591 missense probably benign 0.39
R7026:Olfr1461 UTSW 19 13165415 missense probably benign 0.08
Predicted Primers PCR Primer
(F):5'- TCACTGATGATCCAGGCCTG -3'
(R):5'- AGAGAGCCATGATTGCTGGC -3'

Sequencing Primer
(F):5'- ATGATCCAGGCCTGCAGCTTC -3'
(R):5'- GAGCCATGATTGCTGGCATATCAC -3'
Posted On2015-09-25