Incidental Mutation 'R4606:Pou3f1'
ID346000
Institutional Source Beutler Lab
Gene Symbol Pou3f1
Ensembl Gene ENSMUSG00000090125
Gene NamePOU domain, class 3, transcription factor 1
SynonymsOct-6, Otf6, Tst1, Scip, Test1, Tst-1, Oct6
MMRRC Submission 041817-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4606 (G1)
Quality Score221
Status Validated
Chromosome4
Chromosomal Location124656807-124660655 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 124658836 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Valine at position 377 (E377V)
Ref Sequence ENSEMBL: ENSMUSP00000137374 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053491]
PDB Structure
CRYSTAL STRUCTURE OF THE DIMERIC OCT-6 (POU3F1) POU DOMAIN BOUND TO PALINDROMIC MORE DNA [X-RAY DIFFRACTION]
Predicted Effect probably damaging
Transcript: ENSMUST00000053491
AA Change: E377V

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000137374
Gene: ENSMUSG00000090125
AA Change: E377V

DomainStartEndE-ValueType
low complexity region 9 21 N/A INTRINSIC
low complexity region 27 43 N/A INTRINSIC
low complexity region 75 109 N/A INTRINSIC
low complexity region 116 134 N/A INTRINSIC
low complexity region 136 148 N/A INTRINSIC
low complexity region 154 189 N/A INTRINSIC
low complexity region 202 236 N/A INTRINSIC
POU 245 319 1.26e-52 SMART
HOX 337 399 2.15e-17 SMART
low complexity region 411 447 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000184062
Meta Mutation Damage Score 0.3942 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.0%
Validation Efficiency 96% (69/72)
MGI Phenotype PHENOTYPE: Homozygotes for targeted null mutations exhibit cyanosis and respiratory distress at birth and defective peripheral myelination due to arrested Scwann cell maturation. Mutants usually die at birth or shortly thereafter. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700011L22Rik A T 8: 79,210,745 W178R probably benign Het
Abcb5 T C 12: 118,932,610 probably null Het
Akr1b3 C A 6: 34,306,664 probably benign Het
Arid1a A G 4: 133,687,323 F1199S unknown Het
Atp4b A G 8: 13,389,998 F116S probably damaging Het
Atp6v1b1 T C 6: 83,752,461 S127P probably damaging Het
Blk C T 14: 63,374,203 V428I probably benign Het
C87414 A T 5: 93,636,602 D137E probably damaging Het
Ccser1 T C 6: 61,311,584 S244P probably damaging Het
Ceacam1 T A 7: 25,474,526 I235F probably damaging Het
Cyp2g1 T A 7: 26,814,154 Y173N possibly damaging Het
Ddr2 T A 1: 170,001,852 I278F probably benign Het
Degs1 T C 1: 182,276,823 D299G probably damaging Het
Dip2b G A 15: 100,215,329 V1542I possibly damaging Het
Dmxl1 T A 18: 49,962,181 S2942R probably damaging Het
Dpf1 T A 7: 29,316,590 probably benign Het
Ephb6 A G 6: 41,616,574 Y518C probably benign Het
Eps15l1 A T 8: 72,373,916 F606I possibly damaging Het
Extl1 A G 4: 134,371,379 S114P probably damaging Het
Extl1 A C 4: 134,371,380 D113E probably benign Het
Fat1 T C 8: 44,950,683 V157A possibly damaging Het
Fcho1 A T 8: 71,712,480 D444E probably benign Het
Fgd3 T A 13: 49,296,560 D71V probably damaging Het
Fgd5 T A 6: 91,988,209 D316E possibly damaging Het
Gys2 A T 6: 142,454,484 F334I possibly damaging Het
Ik G T 18: 36,753,555 R360L possibly damaging Het
Kazn A C 4: 142,118,288 probably null Het
Kmt2d A T 15: 98,839,716 probably benign Het
Krr1 T C 10: 111,975,677 probably benign Het
Krt83 C T 15: 101,487,049 E389K probably benign Het
Lrrc4c T C 2: 97,630,313 V428A probably benign Het
Lvrn C A 18: 46,864,765 T260K possibly damaging Het
Mcc C T 18: 44,468,421 E614K probably damaging Het
Msrb3 A T 10: 120,849,997 V81D probably damaging Het
Muc19 C T 15: 91,934,383 noncoding transcript Het
Myadm T A 7: 3,297,400 L226* probably null Het
Myof C T 19: 37,967,099 V526M probably damaging Het
Nckap5l A G 15: 99,429,323 probably benign Het
Olfr1010 T A 2: 85,753,940 probably benign Het
Olfr1260 C A 2: 89,978,006 A76D possibly damaging Het
Olfr1270 G T 2: 90,148,816 probably benign Het
Olfr398 A G 11: 73,983,892 S239P probably damaging Het
Pars2 T C 4: 106,654,050 V307A probably benign Het
Pcdhb1 T G 18: 37,265,528 Y177* probably null Het
Pcdhb4 T A 18: 37,308,652 D338E probably damaging Het
Pik3r2 G A 8: 70,772,136 R199* probably null Het
Pla2g4f C T 2: 120,313,986 R24Q probably benign Het
Pnma2 T C 14: 66,916,232 I35T probably benign Het
Podn C A 4: 108,017,867 A568S probably benign Het
Ppfia1 T C 7: 144,485,192 D494G probably damaging Het
Ptpn9 A T 9: 57,022,211 T71S possibly damaging Het
Ptprz1 C T 6: 23,001,487 P1192L possibly damaging Het
Rnd2 C T 11: 101,468,999 L57F probably damaging Het
Rnf217 T A 10: 31,517,476 K370* probably null Het
Rpap2 G A 5: 107,601,795 V62I possibly damaging Het
Scaper A T 9: 55,655,903 probably null Het
Sos2 T C 12: 69,614,606 probably benign Het
Sptbn5 C T 2: 120,067,446 probably null Het
Sumo1 A G 1: 59,644,509 probably benign Het
Syne2 C A 12: 75,989,253 N3771K probably damaging Het
Tbx18 T C 9: 87,730,769 I26V possibly damaging Het
Trpm3 T A 19: 22,978,624 M1140K probably benign Het
Usp29 G A 7: 6,963,357 probably null Het
Wdr7 C T 18: 63,779,945 Q946* probably null Het
Ythdf1 T C 2: 180,912,182 D46G probably damaging Het
Zfp217 T C 2: 170,119,750 N219S possibly damaging Het
Zkscan3 A G 13: 21,393,783 I256T probably benign Het
Other mutations in Pou3f1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01700:Pou3f1 APN 4 124658857 missense probably damaging 1.00
IGL02981:Pou3f1 APN 4 124658443 missense probably damaging 0.99
R0433:Pou3f1 UTSW 4 124658904 missense probably damaging 1.00
R5033:Pou3f1 UTSW 4 124658656 missense probably damaging 1.00
R7807:Pou3f1 UTSW 4 124658281 missense possibly damaging 0.85
R7891:Pou3f1 UTSW 4 124658439 missense probably damaging 0.99
R7974:Pou3f1 UTSW 4 124658439 missense probably damaging 0.99
R8008:Pou3f1 UTSW 4 124658971 missense unknown
RF016:Pou3f1 UTSW 4 124657809 small insertion probably benign
RF032:Pou3f1 UTSW 4 124657805 small insertion probably benign
RF050:Pou3f1 UTSW 4 124657804 small insertion probably benign
RF055:Pou3f1 UTSW 4 124657796 small insertion probably benign
RF060:Pou3f1 UTSW 4 124657809 small insertion probably benign
Predicted Primers PCR Primer
(F):5'- TGCTCAACAAGTGGCTGGAG -3'
(R):5'- GCATTCTGGATCTTCCGCTG -3'

Sequencing Primer
(F):5'- AGGAGACCGACTCGTCCAG -3'
(R):5'- AGGGTCACTGCACAGAGC -3'
Posted On2015-09-25