Incidental Mutation 'R4606:Ptprz1'
ID346007
Institutional Source Beutler Lab
Gene Symbol Ptprz1
Ensembl Gene ENSMUSG00000068748
Gene Nameprotein tyrosine phosphatase, receptor type Z, polypeptide 1
SynonymsPTPzeta, RPTPz, phosphacan, Rptpbeta, DSD-1-PG, PTPbeta, Ptprz, Ptpz
MMRRC Submission 041817-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.536) question?
Stock #R4606 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location22875502-23052916 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 23001487 bp
ZygosityHeterozygous
Amino Acid Change Proline to Leucine at position 1192 (P1192L)
Ref Sequence ENSEMBL: ENSMUSP00000144605 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000090568] [ENSMUST00000202102] [ENSMUST00000202579]
Predicted Effect possibly damaging
Transcript: ENSMUST00000090568
AA Change: P1192L

PolyPhen 2 Score 0.660 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000088056
Gene: ENSMUSG00000068748
AA Change: P1192L

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Carb_anhydrase 38 300 5.12e-99 SMART
FN3 312 397 5.53e-4 SMART
low complexity region 588 609 N/A INTRINSIC
low complexity region 825 837 N/A INTRINSIC
low complexity region 1417 1441 N/A INTRINSIC
low complexity region 1485 1495 N/A INTRINSIC
Blast:PTPc 1497 1573 1e-12 BLAST
low complexity region 1606 1620 N/A INTRINSIC
transmembrane domain 1637 1659 N/A INTRINSIC
low complexity region 1679 1693 N/A INTRINSIC
PTPc 1720 1991 2.8e-130 SMART
PTPc 2019 2281 1.65e-77 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000201827
Predicted Effect probably benign
Transcript: ENSMUST00000202102
SMART Domains Protein: ENSMUSP00000143902
Gene: ENSMUSG00000068748

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Carb_anhydrase 38 300 5.12e-99 SMART
FN3 312 397 5.53e-4 SMART
low complexity region 588 609 N/A INTRINSIC
transmembrane domain 788 810 N/A INTRINSIC
low complexity region 830 844 N/A INTRINSIC
PTPc 871 1142 2.8e-130 SMART
PTPc 1170 1432 1.65e-77 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000202579
AA Change: P1192L

PolyPhen 2 Score 0.795 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000144605
Gene: ENSMUSG00000068748
AA Change: P1192L

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Carb_anhydrase 38 300 4e-103 SMART
FN3 312 397 2.8e-6 SMART
low complexity region 588 609 N/A INTRINSIC
low complexity region 825 837 N/A INTRINSIC
low complexity region 1417 1441 N/A INTRINSIC
low complexity region 1485 1495 N/A INTRINSIC
Meta Mutation Damage Score 0.0784 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.0%
Validation Efficiency 96% (69/72)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the receptor protein tyrosine phosphatase family. Expression of this gene is restricted to the central nervous system (CNS), and it may be involved in the regulation of specific developmental processes in the CNS. Alternatively spliced transcript variants encoding different isoforms have been described for this gene. [provided by RefSeq, May 2011]
PHENOTYPE: Mice homozygous for targeted null mutations demonstrate an impaired ability to recover from inflamatory lesions of the CNS or gastric mucosa. Mice homozygous for a knock-out allele exhibit increased tactile and thermal nociception thresholds. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700011L22Rik A T 8: 79,210,745 W178R probably benign Het
Abcb5 T C 12: 118,932,610 probably null Het
Akr1b3 C A 6: 34,306,664 probably benign Het
Arid1a A G 4: 133,687,323 F1199S unknown Het
Atp4b A G 8: 13,389,998 F116S probably damaging Het
Atp6v1b1 T C 6: 83,752,461 S127P probably damaging Het
Blk C T 14: 63,374,203 V428I probably benign Het
C87414 A T 5: 93,636,602 D137E probably damaging Het
Ccser1 T C 6: 61,311,584 S244P probably damaging Het
Ceacam1 T A 7: 25,474,526 I235F probably damaging Het
Cyp2g1 T A 7: 26,814,154 Y173N possibly damaging Het
Ddr2 T A 1: 170,001,852 I278F probably benign Het
Degs1 T C 1: 182,276,823 D299G probably damaging Het
Dip2b G A 15: 100,215,329 V1542I possibly damaging Het
Dmxl1 T A 18: 49,962,181 S2942R probably damaging Het
Dpf1 T A 7: 29,316,590 probably benign Het
Ephb6 A G 6: 41,616,574 Y518C probably benign Het
Eps15l1 A T 8: 72,373,916 F606I possibly damaging Het
Extl1 A G 4: 134,371,379 S114P probably damaging Het
Extl1 A C 4: 134,371,380 D113E probably benign Het
Fat1 T C 8: 44,950,683 V157A possibly damaging Het
Fcho1 A T 8: 71,712,480 D444E probably benign Het
Fgd3 T A 13: 49,296,560 D71V probably damaging Het
Fgd5 T A 6: 91,988,209 D316E possibly damaging Het
Gys2 A T 6: 142,454,484 F334I possibly damaging Het
Ik G T 18: 36,753,555 R360L possibly damaging Het
Kazn A C 4: 142,118,288 probably null Het
Kmt2d A T 15: 98,839,716 probably benign Het
Krr1 T C 10: 111,975,677 probably benign Het
Krt83 C T 15: 101,487,049 E389K probably benign Het
Lrrc4c T C 2: 97,630,313 V428A probably benign Het
Lvrn C A 18: 46,864,765 T260K possibly damaging Het
Mcc C T 18: 44,468,421 E614K probably damaging Het
Msrb3 A T 10: 120,849,997 V81D probably damaging Het
Muc19 C T 15: 91,934,383 noncoding transcript Het
Myadm T A 7: 3,297,400 L226* probably null Het
Myof C T 19: 37,967,099 V526M probably damaging Het
Nckap5l A G 15: 99,429,323 probably benign Het
Olfr1010 T A 2: 85,753,940 probably benign Het
Olfr1260 C A 2: 89,978,006 A76D possibly damaging Het
Olfr1270 G T 2: 90,148,816 probably benign Het
Olfr398 A G 11: 73,983,892 S239P probably damaging Het
Pars2 T C 4: 106,654,050 V307A probably benign Het
Pcdhb1 T G 18: 37,265,528 Y177* probably null Het
Pcdhb4 T A 18: 37,308,652 D338E probably damaging Het
Pik3r2 G A 8: 70,772,136 R199* probably null Het
Pla2g4f C T 2: 120,313,986 R24Q probably benign Het
Pnma2 T C 14: 66,916,232 I35T probably benign Het
Podn C A 4: 108,017,867 A568S probably benign Het
Pou3f1 A T 4: 124,658,836 E377V probably damaging Het
Ppfia1 T C 7: 144,485,192 D494G probably damaging Het
Ptpn9 A T 9: 57,022,211 T71S possibly damaging Het
Rnd2 C T 11: 101,468,999 L57F probably damaging Het
Rnf217 T A 10: 31,517,476 K370* probably null Het
Rpap2 G A 5: 107,601,795 V62I possibly damaging Het
Scaper A T 9: 55,655,903 probably null Het
Sos2 T C 12: 69,614,606 probably benign Het
Sptbn5 C T 2: 120,067,446 probably null Het
Sumo1 A G 1: 59,644,509 probably benign Het
Syne2 C A 12: 75,989,253 N3771K probably damaging Het
Tbx18 T C 9: 87,730,769 I26V possibly damaging Het
Trpm3 T A 19: 22,978,624 M1140K probably benign Het
Usp29 G A 7: 6,963,357 probably null Het
Wdr7 C T 18: 63,779,945 Q946* probably null Het
Ythdf1 T C 2: 180,912,182 D46G probably damaging Het
Zfp217 T C 2: 170,119,750 N219S possibly damaging Het
Zkscan3 A G 13: 21,393,783 I256T probably benign Het
Other mutations in Ptprz1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00486:Ptprz1 APN 6 22973054 missense probably damaging 1.00
IGL00773:Ptprz1 APN 6 23002629 missense probably benign 0.41
IGL01458:Ptprz1 APN 6 22972844 missense probably damaging 0.99
IGL01481:Ptprz1 APN 6 22999980 missense probably benign 0.05
IGL01501:Ptprz1 APN 6 22973082 missense probably damaging 1.00
IGL01601:Ptprz1 APN 6 23000438 missense probably damaging 0.99
IGL01882:Ptprz1 APN 6 23000464 missense probably damaging 1.00
IGL02058:Ptprz1 APN 6 23002503 missense probably benign 0.00
IGL02089:Ptprz1 APN 6 23033448 missense probably damaging 1.00
IGL02136:Ptprz1 APN 6 22972822 missense probably damaging 1.00
IGL02215:Ptprz1 APN 6 22965182 missense possibly damaging 0.91
IGL02220:Ptprz1 APN 6 23042743 splice site probably benign
IGL02556:Ptprz1 APN 6 22972845 missense probably benign 0.01
IGL02601:Ptprz1 APN 6 23000687 missense probably benign 0.11
IGL02620:Ptprz1 APN 6 22959740 missense probably damaging 1.00
IGL02666:Ptprz1 APN 6 23001210 missense probably benign 0.00
IGL02718:Ptprz1 APN 6 23001349 missense possibly damaging 0.77
IGL02792:Ptprz1 APN 6 22959723 missense probably damaging 1.00
IGL02894:Ptprz1 APN 6 23035149 missense probably damaging 1.00
IGL02952:Ptprz1 APN 6 23036926 missense probably damaging 1.00
IGL03003:Ptprz1 APN 6 23002583 missense probably damaging 0.98
IGL03060:Ptprz1 APN 6 22972835 missense probably damaging 1.00
IGL03170:Ptprz1 APN 6 22959767 missense probably benign 0.00
IGL03246:Ptprz1 APN 6 22986160 missense probably damaging 0.99
IGL03349:Ptprz1 APN 6 23000332 missense probably damaging 1.00
IGL03365:Ptprz1 APN 6 23030582 splice site probably benign
R0044:Ptprz1 UTSW 6 23007403 missense probably damaging 1.00
R0054:Ptprz1 UTSW 6 22986196 missense probably damaging 1.00
R0054:Ptprz1 UTSW 6 22986196 missense probably damaging 1.00
R0107:Ptprz1 UTSW 6 23000570 missense probably damaging 0.98
R0278:Ptprz1 UTSW 6 23000817 missense probably benign 0.31
R0345:Ptprz1 UTSW 6 23016165 missense probably damaging 1.00
R0359:Ptprz1 UTSW 6 22973176 splice site probably benign
R0743:Ptprz1 UTSW 6 23044367 nonsense probably null
R1014:Ptprz1 UTSW 6 23000644 missense probably damaging 1.00
R1016:Ptprz1 UTSW 6 23000974 missense probably damaging 1.00
R1106:Ptprz1 UTSW 6 22965749 missense probably damaging 0.99
R1391:Ptprz1 UTSW 6 23001729 missense probably benign 0.33
R1424:Ptprz1 UTSW 6 23000383 missense probably benign 0.00
R1445:Ptprz1 UTSW 6 23050474 missense probably damaging 1.00
R1496:Ptprz1 UTSW 6 23049524 splice site probably benign
R1544:Ptprz1 UTSW 6 23000748 missense possibly damaging 0.63
R1626:Ptprz1 UTSW 6 23001574 missense probably benign
R1641:Ptprz1 UTSW 6 23049606 missense probably damaging 1.00
R1757:Ptprz1 UTSW 6 23044320 missense probably damaging 1.00
R1812:Ptprz1 UTSW 6 22959712 missense probably benign 0.07
R1917:Ptprz1 UTSW 6 23035040 splice site probably benign
R1930:Ptprz1 UTSW 6 23007355 missense probably damaging 1.00
R1931:Ptprz1 UTSW 6 23007355 missense probably damaging 1.00
R1974:Ptprz1 UTSW 6 22986311 missense probably damaging 1.00
R1992:Ptprz1 UTSW 6 22959748 missense probably benign 0.24
R1997:Ptprz1 UTSW 6 23050497 missense probably damaging 0.99
R2002:Ptprz1 UTSW 6 23027834 nonsense probably null
R2012:Ptprz1 UTSW 6 23001027 missense probably benign 0.03
R2059:Ptprz1 UTSW 6 22986323 splice site probably benign
R2061:Ptprz1 UTSW 6 23049675 critical splice donor site probably null
R2064:Ptprz1 UTSW 6 23050389 splice site probably benign
R2067:Ptprz1 UTSW 6 23050389 splice site probably benign
R2108:Ptprz1 UTSW 6 23033477 missense probably damaging 0.99
R2152:Ptprz1 UTSW 6 23030671 missense probably damaging 0.99
R2166:Ptprz1 UTSW 6 23045633 missense possibly damaging 0.90
R2183:Ptprz1 UTSW 6 23002285 missense probably benign
R2202:Ptprz1 UTSW 6 23000650 missense possibly damaging 0.63
R2238:Ptprz1 UTSW 6 22987377 missense probably damaging 1.00
R2290:Ptprz1 UTSW 6 23000991 missense probably damaging 1.00
R3027:Ptprz1 UTSW 6 23016197 missense possibly damaging 0.89
R3861:Ptprz1 UTSW 6 23036895 missense probably damaging 0.98
R4012:Ptprz1 UTSW 6 23002585 missense probably damaging 0.99
R4020:Ptprz1 UTSW 6 22959624 splice site probably benign
R4158:Ptprz1 UTSW 6 23001684 nonsense probably null
R4158:Ptprz1 UTSW 6 23022205 missense possibly damaging 0.73
R4159:Ptprz1 UTSW 6 23001684 nonsense probably null
R4160:Ptprz1 UTSW 6 23022205 missense possibly damaging 0.73
R4621:Ptprz1 UTSW 6 23001454 missense possibly damaging 0.68
R4640:Ptprz1 UTSW 6 22972798 missense probably damaging 1.00
R4731:Ptprz1 UTSW 6 23002610 missense probably benign 0.06
R4732:Ptprz1 UTSW 6 23002610 missense probably benign 0.06
R4733:Ptprz1 UTSW 6 23002610 missense probably benign 0.06
R4803:Ptprz1 UTSW 6 23001546 missense probably benign 0.00
R4890:Ptprz1 UTSW 6 23024958 missense probably damaging 1.00
R5035:Ptprz1 UTSW 6 23016215 missense probably benign 0.06
R5052:Ptprz1 UTSW 6 23045626 missense probably damaging 1.00
R5106:Ptprz1 UTSW 6 23000028 missense probably benign 0.04
R5248:Ptprz1 UTSW 6 23001901 missense probably benign 0.11
R5292:Ptprz1 UTSW 6 23002582 missense probably benign 0.31
R5373:Ptprz1 UTSW 6 23007355 missense probably damaging 1.00
R5374:Ptprz1 UTSW 6 23007355 missense probably damaging 1.00
R5378:Ptprz1 UTSW 6 23007402 missense probably damaging 1.00
R5408:Ptprz1 UTSW 6 23002600 missense probably damaging 1.00
R5479:Ptprz1 UTSW 6 23001666 missense probably benign
R5524:Ptprz1 UTSW 6 22986318 splice site probably null
R5527:Ptprz1 UTSW 6 23000053 missense possibly damaging 0.66
R5557:Ptprz1 UTSW 6 23001001 missense probably benign 0.04
R5654:Ptprz1 UTSW 6 22986134 missense probably damaging 1.00
R5655:Ptprz1 UTSW 6 22999773 missense probably benign 0.00
R5658:Ptprz1 UTSW 6 23016189 missense probably damaging 1.00
R5663:Ptprz1 UTSW 6 23035143 missense probably damaging 1.00
R5765:Ptprz1 UTSW 6 23000236 missense probably damaging 1.00
R5822:Ptprz1 UTSW 6 23001445 missense probably benign 0.01
R5837:Ptprz1 UTSW 6 23001418 missense probably benign 0.00
R6108:Ptprz1 UTSW 6 23045659 missense probably damaging 1.00
R6199:Ptprz1 UTSW 6 23002471 missense probably benign 0.01
R6245:Ptprz1 UTSW 6 23051990 missense probably damaging 1.00
R6257:Ptprz1 UTSW 6 22959640 missense probably damaging 1.00
R6488:Ptprz1 UTSW 6 23001517 nonsense probably null
R6606:Ptprz1 UTSW 6 23002501 missense probably benign 0.27
R6612:Ptprz1 UTSW 6 23052082 missense probably damaging 1.00
R6824:Ptprz1 UTSW 6 23002131 missense probably benign 0.05
R6834:Ptprz1 UTSW 6 22999633 missense probably benign 0.38
R6836:Ptprz1 UTSW 6 23030665 nonsense probably null
R6991:Ptprz1 UTSW 6 23002687 missense probably benign 0.00
R7044:Ptprz1 UTSW 6 23044346 missense probably damaging 1.00
R7048:Ptprz1 UTSW 6 22961623 missense probably benign 0.18
R7225:Ptprz1 UTSW 6 23000929 missense possibly damaging 0.61
R7284:Ptprz1 UTSW 6 23000098 missense probably damaging 1.00
R7360:Ptprz1 UTSW 6 23000907 missense probably damaging 1.00
R7501:Ptprz1 UTSW 6 23001747 nonsense probably null
R7515:Ptprz1 UTSW 6 23022267 missense probably damaging 1.00
R7538:Ptprz1 UTSW 6 22999896 missense possibly damaging 0.81
R7567:Ptprz1 UTSW 6 22959780 missense probably damaging 0.97
R7599:Ptprz1 UTSW 6 23002519 missense not run
R7611:Ptprz1 UTSW 6 23001220 missense probably benign
R7685:Ptprz1 UTSW 6 23024978 missense probably damaging 1.00
R7707:Ptprz1 UTSW 6 23002296 missense probably benign 0.00
R7733:Ptprz1 UTSW 6 23000384 missense probably benign 0.31
R7786:Ptprz1 UTSW 6 23036993 missense probably damaging 1.00
R7868:Ptprz1 UTSW 6 23000964 missense not run
R7882:Ptprz1 UTSW 6 23002257 missense probably benign 0.13
R7968:Ptprz1 UTSW 6 22959676 missense probably damaging 0.98
R8024:Ptprz1 UTSW 6 23042751 missense probably damaging 1.00
R8157:Ptprz1 UTSW 6 23002540 missense probably damaging 1.00
R8159:Ptprz1 UTSW 6 23001663 missense probably benign
Z1176:Ptprz1 UTSW 6 23051995 missense probably damaging 0.99
Z1177:Ptprz1 UTSW 6 22999840 missense possibly damaging 0.51
Z1177:Ptprz1 UTSW 6 23052024 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAACTAAGGGTTTTGAACAGGG -3'
(R):5'- CAGACGTAAAGTGCAGCATGC -3'

Sequencing Primer
(F):5'- AACAGGGGGTTAGTCACGTTCC -3'
(R):5'- AAAGTGCAGCATGCTTTCGC -3'
Posted On2015-09-25