Incidental Mutation 'R0254:Scn8a'
ID 34601
Institutional Source Beutler Lab
Gene Symbol Scn8a
Ensembl Gene ENSMUSG00000023033
Gene Name sodium channel, voltage-gated, type VIII, alpha
Synonyms nmf335, nmf58, NMF335, C630029C19Rik, nur14, mnd2, seal, mnd-2, nmf2, med, ataxia 3, NaCh6, Nav1.6, motor end-plate disease
MMRRC Submission 038485-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.790) question?
Stock # R0254 (G1)
Quality Score 225
Status Validated
Chromosome 15
Chromosomal Location 100767739-100943819 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 100916245 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Asparagine at position 1218 (I1218N)
Ref Sequence ENSEMBL: ENSMUSP00000144371 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000082209] [ENSMUST00000108908] [ENSMUST00000108909] [ENSMUST00000108910] [ENSMUST00000200963] [ENSMUST00000201549]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000082209
AA Change: I1218N

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000080842
Gene: ENSMUSG00000023033
AA Change: I1218N

DomainStartEndE-ValueType
Pfam:Ion_trans 131 422 7.4e-82 PFAM
low complexity region 423 452 N/A INTRINSIC
Pfam:Na_trans_cytopl 499 700 3.5e-72 PFAM
low complexity region 701 712 N/A INTRINSIC
Pfam:Ion_trans 750 985 2.2e-57 PFAM
Pfam:Na_trans_assoc 989 1191 2e-59 PFAM
Pfam:Ion_trans 1195 1472 6.2e-69 PFAM
Pfam:Ion_trans 1519 1775 1.2e-56 PFAM
IQ 1892 1914 1.2e-4 SMART
low complexity region 1953 1972 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000108908
AA Change: I1218N

PolyPhen 2 Score 0.964 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000104536
Gene: ENSMUSG00000023033
AA Change: I1218N

DomainStartEndE-ValueType
Pfam:Ion_trans 72 322 1.9e-76 PFAM
low complexity region 367 378 N/A INTRINSIC
Pfam:Ion_trans 451 640 1.1e-47 PFAM
Pfam:Na_trans_assoc 655 872 1.9e-71 PFAM
Pfam:Ion_trans 898 1127 4.4e-59 PFAM
PDB:1BYY|A 1129 1181 7e-30 PDB
Pfam:Ion_trans 1220 1429 1.9e-51 PFAM
Pfam:PKD_channel 1281 1436 5.6e-7 PFAM
IQ 1558 1580 1.2e-4 SMART
low complexity region 1619 1638 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000108909
AA Change: I1228N

PolyPhen 2 Score 0.282 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000104537
Gene: ENSMUSG00000023033
AA Change: I1228N

DomainStartEndE-ValueType
Pfam:Ion_trans 72 322 2.2e-76 PFAM
low complexity region 335 364 N/A INTRINSIC
Pfam:DUF3451 390 616 8.7e-70 PFAM
Pfam:Ion_trans 697 886 1.3e-47 PFAM
Pfam:Na_trans_assoc 901 1118 2.3e-71 PFAM
Pfam:Ion_trans 1144 1186 9.7e-10 PFAM
Pfam:Ion_trans 1182 1332 1.7e-31 PFAM
PDB:1BYY|A 1334 1386 2e-29 PDB
Pfam:Ion_trans 1425 1634 2.3e-51 PFAM
Pfam:PKD_channel 1486 1641 6.6e-7 PFAM
IQ 1763 1785 1.2e-4 SMART
low complexity region 1824 1843 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000108910
AA Change: I1218N

PolyPhen 2 Score 0.282 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000104538
Gene: ENSMUSG00000023033
AA Change: I1218N

DomainStartEndE-ValueType
Pfam:Ion_trans 160 410 2.5e-76 PFAM
low complexity region 423 452 N/A INTRINSIC
Pfam:DUF3451 478 704 9.6e-70 PFAM
Pfam:Ion_trans 785 974 1.4e-47 PFAM
Pfam:Na_trans_assoc 989 1206 2.5e-71 PFAM
Pfam:Ion_trans 1232 1461 5.7e-59 PFAM
PDB:1BYY|A 1463 1515 4e-29 PDB
Pfam:Ion_trans 1554 1763 2.5e-51 PFAM
Pfam:PKD_channel 1615 1770 7.1e-7 PFAM
IQ 1892 1914 1.2e-4 SMART
low complexity region 1953 1972 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000200963
AA Change: I1218N

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000144371
Gene: ENSMUSG00000023033
AA Change: I1218N

DomainStartEndE-ValueType
Pfam:Ion_trans 131 422 4.1e-80 PFAM
low complexity region 423 452 N/A INTRINSIC
Pfam:Na_trans_cytopl 499 700 2.5e-69 PFAM
low complexity region 701 712 N/A INTRINSIC
Pfam:Ion_trans 750 985 1.2e-55 PFAM
Pfam:Na_trans_assoc 989 1191 9.1e-57 PFAM
Pfam:Ion_trans 1195 1274 7.6e-16 PFAM
Pfam:Ion_trans 1270 1431 2.6e-33 PFAM
Pfam:Ion_trans 1478 1734 6.5e-55 PFAM
IQ 1851 1873 6e-7 SMART
low complexity region 1912 1931 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000201246
Predicted Effect probably damaging
Transcript: ENSMUST00000201549
AA Change: I1218N

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000144013
Gene: ENSMUSG00000023033
AA Change: I1218N

DomainStartEndE-ValueType
Pfam:Ion_trans 131 422 7.4e-82 PFAM
low complexity region 423 452 N/A INTRINSIC
Pfam:Na_trans_cytopl 499 700 3.5e-72 PFAM
low complexity region 701 712 N/A INTRINSIC
Pfam:Ion_trans 750 985 2.2e-57 PFAM
Pfam:Na_trans_assoc 989 1191 2e-59 PFAM
Pfam:Ion_trans 1195 1472 6.2e-69 PFAM
Pfam:Ion_trans 1519 1775 1.2e-56 PFAM
IQ 1892 1914 1.2e-4 SMART
low complexity region 1953 1972 N/A INTRINSIC
Meta Mutation Damage Score 0.5901 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.1%
  • 20x: 91.7%
Validation Efficiency 100% (100/100)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the sodium channel alpha subunit gene family. The encoded protein forms the ion pore region of the voltage-gated sodium channel. This protein is essential for the rapid membrane depolarization that occurs during the formation of the action potential in excitable neurons. Mutations in this gene are associated with mental retardation, pancerebellar atrophy and ataxia. Alternate splicing results in multiple transcript variants.[provided by RefSeq, May 2010]
PHENOTYPE: Spontaneous mutant homozygotes have ataxia, dystonia, muscular atrophy, progressive paralysis, Purkinje cell loss, in some cases severe head-tossing and for severe alleles, juvenile lethality. A mild, semidominant ENU allele causes deafness of variable penetrance and severity and mild tremor. [provided by MGI curators]
Allele List at MGI

 All alleles(22) : Targeted, knock-out(1) Targeted, other(1) Gene trapped(6) Transgenic(1) Spontaneous(5) Chemically induced(8)

Other mutations in this stock
Total: 97 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700034J05Rik T A 6: 146,853,902 (GRCm39) M252L probably benign Het
Abca6 A G 11: 110,127,615 (GRCm39) V314A probably benign Het
Abcb1b A T 5: 8,877,409 (GRCm39) E656D probably benign Het
Abhd4 T C 14: 54,500,691 (GRCm39) I160T probably benign Het
Aco2 T C 15: 81,773,557 (GRCm39) V32A probably damaging Het
Actl6b A G 5: 137,552,406 (GRCm39) probably benign Het
Akap13 T C 7: 75,386,352 (GRCm39) probably benign Het
Alpk3 A T 7: 80,726,722 (GRCm39) T136S probably benign Het
Ap1g1 G T 8: 110,529,749 (GRCm39) M56I probably benign Het
Arid2 C T 15: 96,268,452 (GRCm39) T855I probably damaging Het
Asprv1 T C 6: 86,606,077 (GRCm39) F308L probably damaging Het
Ass1 A T 2: 31,404,831 (GRCm39) N371Y probably damaging Het
Atp11b T A 3: 35,866,259 (GRCm39) M378K possibly damaging Het
Atp1a3 T C 7: 24,680,937 (GRCm39) probably benign Het
Blk C A 14: 63,618,253 (GRCm39) A218S probably benign Het
C4b T A 17: 34,953,750 (GRCm39) T953S probably benign Het
Cdadc1 T C 14: 59,813,356 (GRCm39) probably benign Het
Cdca2 C A 14: 67,914,627 (GRCm39) L877F probably damaging Het
Ceacam10 G T 7: 24,477,733 (GRCm39) V83L probably damaging Het
Cep290 A T 10: 100,350,436 (GRCm39) I677F probably benign Het
Clip1 A T 5: 123,755,395 (GRCm39) probably benign Het
Col11a2 G T 17: 34,283,777 (GRCm39) probably benign Het
Coro1c A T 5: 113,983,313 (GRCm39) V405D probably benign Het
Crebrf A G 17: 26,958,568 (GRCm39) T13A probably benign Het
Cspg4 A G 9: 56,804,694 (GRCm39) E1835G probably damaging Het
Cubn A T 2: 13,480,846 (GRCm39) probably null Het
Cubn T C 2: 13,429,505 (GRCm39) N1332S probably benign Het
Cubn T C 2: 13,445,325 (GRCm39) T1014A possibly damaging Het
Efnb1 T C X: 98,180,634 (GRCm39) probably benign Het
Elf2 G T 3: 51,215,611 (GRCm39) P33Q probably damaging Het
Fap C T 2: 62,333,746 (GRCm39) G633D probably damaging Het
Gm10288 T C 3: 146,544,675 (GRCm39) noncoding transcript Het
Got2 T C 8: 96,596,166 (GRCm39) N318S probably benign Het
Guk1 A T 11: 59,076,854 (GRCm39) F76L probably damaging Het
H2-K2 A T 17: 34,215,639 (GRCm39) probably benign Het
Helz2 C A 2: 180,874,552 (GRCm39) G1981C probably damaging Het
Hinfp G A 9: 44,209,536 (GRCm39) H250Y probably damaging Het
Hnrnpm C T 17: 33,871,242 (GRCm39) probably null Het
Hsd11b2 T A 8: 106,249,699 (GRCm39) V270E possibly damaging Het
Igbp1b A T 6: 138,635,201 (GRCm39) M81K probably damaging Het
Kif11 A G 19: 37,399,957 (GRCm39) T815A probably benign Het
Kit G A 5: 75,781,581 (GRCm39) V337I probably benign Het
Klf11 T C 12: 24,703,582 (GRCm39) S6P probably damaging Het
Klk13 T C 7: 43,373,245 (GRCm39) V193A probably benign Het
Krt73 T A 15: 101,708,324 (GRCm39) probably benign Het
L1td1 T A 4: 98,625,419 (GRCm39) L538* probably null Het
Macf1 A G 4: 123,326,572 (GRCm39) L2061P probably damaging Het
Mcm2 A G 6: 88,860,998 (GRCm39) I900T probably damaging Het
Med16 A T 10: 79,736,034 (GRCm39) N371K possibly damaging Het
Mepce A C 5: 137,783,698 (GRCm39) D209E possibly damaging Het
Mrc2 C G 11: 105,238,692 (GRCm39) P1249R probably benign Het
Mx2 A T 16: 97,357,295 (GRCm39) I463L probably benign Het
Naaa A T 5: 92,412,994 (GRCm39) N73K probably damaging Het
Nags T A 11: 102,038,771 (GRCm39) L404Q probably damaging Het
Neb A G 2: 52,133,402 (GRCm39) Y3379H probably damaging Het
Nhsl1 A G 10: 18,348,733 (GRCm39) E120G probably damaging Het
Or11j4 T C 14: 50,630,536 (GRCm39) S108P probably damaging Het
Or4f53 A C 2: 111,087,466 (GRCm39) N2T probably benign Het
Or51a42 T C 7: 103,708,728 (GRCm39) H27R probably benign Het
Or51ah3 T A 7: 103,209,829 (GRCm39) Y48* probably null Het
Or51f5 C A 7: 102,424,076 (GRCm39) S115* probably null Het
Pcnt A G 10: 76,228,414 (GRCm39) F1584L probably benign Het
Pdgfra G A 5: 75,328,596 (GRCm39) V243I probably damaging Het
Polr2a T C 11: 69,634,497 (GRCm39) I689V possibly damaging Het
Ppfia4 C A 1: 134,251,962 (GRCm39) probably benign Het
Prmt8 C A 6: 127,688,771 (GRCm39) V200L probably damaging Het
Prpf8 T A 11: 75,397,188 (GRCm39) I2007N possibly damaging Het
Ptpn6 T C 6: 124,705,113 (GRCm39) E230G probably damaging Het
R3hcc1l G A 19: 42,551,587 (GRCm39) V195I probably damaging Het
Rb1cc1 C T 1: 6,333,071 (GRCm39) T1330I probably damaging Het
Reep3 G T 10: 66,857,575 (GRCm39) T172N probably benign Het
Rfwd3 A G 8: 112,020,655 (GRCm39) V236A probably benign Het
Rgs22 T C 15: 36,104,698 (GRCm39) I121V probably damaging Het
Robo1 T A 16: 72,461,058 (GRCm39) F11I probably benign Het
Rsrc2 A G 5: 123,878,910 (GRCm39) probably benign Het
Rubcn A G 16: 32,668,316 (GRCm39) V117A probably benign Het
Scamp1 T G 13: 94,347,088 (GRCm39) N192T probably benign Het
Serinc1 A G 10: 57,399,304 (GRCm39) S200P probably damaging Het
Serpinb9f T A 13: 33,518,574 (GRCm39) F358Y probably damaging Het
Slc12a5 T C 2: 164,839,165 (GRCm39) probably null Het
Slc5a4b T C 10: 75,906,462 (GRCm39) M386V possibly damaging Het
Smarca5 A G 8: 81,431,329 (GRCm39) F963L probably benign Het
Smchd1 A T 17: 71,718,886 (GRCm39) F828I probably benign Het
Smr2l A T 5: 88,430,230 (GRCm39) H42L possibly damaging Het
Stab2 G T 10: 86,733,824 (GRCm39) Q1333K probably benign Het
Svop T C 5: 114,176,600 (GRCm39) S349G probably benign Het
Tdrd1 G A 19: 56,830,998 (GRCm39) S271N probably benign Het
Tec G A 5: 72,941,081 (GRCm39) P159S probably benign Het
Tec T C 5: 72,920,899 (GRCm39) probably benign Het
Tfip11 G A 5: 112,483,521 (GRCm39) M645I probably benign Het
Thap12 A T 7: 98,364,488 (GRCm39) T219S probably benign Het
Tmem87a C T 2: 120,205,988 (GRCm39) R329H probably damaging Het
Tpsab1 A G 17: 25,562,719 (GRCm39) Y227H probably damaging Het
Urah G A 7: 140,417,602 (GRCm39) V114I probably benign Het
Wnt5a G A 14: 28,244,811 (GRCm39) E353K probably damaging Het
Zfp1004 G A 2: 150,033,784 (GRCm39) R35K possibly damaging Het
Zfp101 A T 17: 33,599,952 (GRCm39) H601Q possibly damaging Het
Other mutations in Scn8a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00230:Scn8a APN 15 100,853,413 (GRCm39) unclassified probably benign
IGL00979:Scn8a APN 15 100,853,287 (GRCm39) unclassified probably benign
IGL01339:Scn8a APN 15 100,930,082 (GRCm39) missense probably benign
IGL01992:Scn8a APN 15 100,866,938 (GRCm39) missense probably damaging 1.00
IGL02215:Scn8a APN 15 100,927,453 (GRCm39) splice site probably null
IGL02311:Scn8a APN 15 100,911,164 (GRCm39) missense probably damaging 0.97
IGL02404:Scn8a APN 15 100,937,611 (GRCm39) missense probably damaging 1.00
IGL02652:Scn8a APN 15 100,911,357 (GRCm39) missense probably damaging 0.98
IGL02690:Scn8a APN 15 100,868,135 (GRCm39) missense probably damaging 1.00
IGL02704:Scn8a APN 15 100,905,943 (GRCm39) missense possibly damaging 0.94
IGL03084:Scn8a APN 15 100,915,053 (GRCm39) missense probably damaging 1.00
IGL03108:Scn8a APN 15 100,872,496 (GRCm39) missense probably benign
IGL03224:Scn8a APN 15 100,933,520 (GRCm39) missense probably damaging 1.00
dan UTSW 15 100,933,505 (GRCm39) nonsense probably null
nymph UTSW 15 100,933,527 (GRCm39) missense probably damaging 1.00
Tremord UTSW 15 100,911,385 (GRCm39) missense probably damaging 1.00
3-1:Scn8a UTSW 15 100,937,820 (GRCm39) missense probably benign 0.04
PIT4280001:Scn8a UTSW 15 100,855,370 (GRCm39) missense probably damaging 1.00
PIT4508001:Scn8a UTSW 15 100,927,573 (GRCm39) missense probably damaging 0.98
R0010:Scn8a UTSW 15 100,911,454 (GRCm39) missense probably damaging 1.00
R0010:Scn8a UTSW 15 100,911,454 (GRCm39) missense probably damaging 1.00
R0412:Scn8a UTSW 15 100,906,187 (GRCm39) splice site probably benign
R0538:Scn8a UTSW 15 100,933,505 (GRCm39) nonsense probably null
R0539:Scn8a UTSW 15 100,914,449 (GRCm39) missense probably damaging 1.00
R0631:Scn8a UTSW 15 100,933,418 (GRCm39) missense probably damaging 1.00
R0726:Scn8a UTSW 15 100,870,711 (GRCm39) missense probably damaging 1.00
R0945:Scn8a UTSW 15 100,913,668 (GRCm39) missense possibly damaging 0.54
R0967:Scn8a UTSW 15 100,933,527 (GRCm39) missense probably damaging 1.00
R1164:Scn8a UTSW 15 100,938,043 (GRCm39) missense probably benign 0.06
R1283:Scn8a UTSW 15 100,867,052 (GRCm39) missense possibly damaging 0.82
R1368:Scn8a UTSW 15 100,933,422 (GRCm39) missense probably damaging 1.00
R1633:Scn8a UTSW 15 100,927,696 (GRCm39) missense probably benign 0.01
R1669:Scn8a UTSW 15 100,909,001 (GRCm39) missense probably damaging 1.00
R1694:Scn8a UTSW 15 100,853,409 (GRCm39) nonsense probably null
R1735:Scn8a UTSW 15 100,913,742 (GRCm39) missense possibly damaging 0.94
R1773:Scn8a UTSW 15 100,937,496 (GRCm39) missense probably damaging 0.97
R1940:Scn8a UTSW 15 100,868,085 (GRCm39) missense probably benign 0.22
R1996:Scn8a UTSW 15 100,922,260 (GRCm39) missense probably damaging 1.00
R2107:Scn8a UTSW 15 100,916,244 (GRCm39) missense probably damaging 0.99
R2251:Scn8a UTSW 15 100,914,987 (GRCm39) missense probably benign 0.02
R2516:Scn8a UTSW 15 100,867,043 (GRCm39) missense probably benign 0.05
R2917:Scn8a UTSW 15 100,937,613 (GRCm39) missense probably damaging 1.00
R3417:Scn8a UTSW 15 100,869,549 (GRCm39) splice site probably benign
R3896:Scn8a UTSW 15 100,933,379 (GRCm39) missense probably benign
R4024:Scn8a UTSW 15 100,937,674 (GRCm39) missense probably damaging 1.00
R4050:Scn8a UTSW 15 100,911,294 (GRCm39) nonsense probably null
R4193:Scn8a UTSW 15 100,869,484 (GRCm39) missense probably damaging 1.00
R4212:Scn8a UTSW 15 100,854,954 (GRCm39) missense possibly damaging 0.88
R4358:Scn8a UTSW 15 100,838,014 (GRCm39) missense probably benign 0.00
R4396:Scn8a UTSW 15 100,870,711 (GRCm39) missense probably damaging 1.00
R4428:Scn8a UTSW 15 100,881,784 (GRCm39) missense probably damaging 1.00
R4452:Scn8a UTSW 15 100,854,972 (GRCm39) missense possibly damaging 0.95
R4631:Scn8a UTSW 15 100,914,384 (GRCm39) nonsense probably null
R4693:Scn8a UTSW 15 100,913,572 (GRCm39) missense probably damaging 1.00
R4765:Scn8a UTSW 15 100,938,352 (GRCm39) missense probably benign 0.07
R4777:Scn8a UTSW 15 100,913,832 (GRCm39) missense probably damaging 1.00
R4949:Scn8a UTSW 15 100,927,663 (GRCm39) missense probably damaging 1.00
R4997:Scn8a UTSW 15 100,854,935 (GRCm39) missense probably damaging 1.00
R5246:Scn8a UTSW 15 100,908,938 (GRCm39) missense probably damaging 1.00
R5566:Scn8a UTSW 15 100,872,415 (GRCm39) missense probably damaging 1.00
R5875:Scn8a UTSW 15 100,870,703 (GRCm39) nonsense probably null
R6031:Scn8a UTSW 15 100,881,865 (GRCm39) missense probably damaging 1.00
R6031:Scn8a UTSW 15 100,881,865 (GRCm39) missense probably damaging 1.00
R6057:Scn8a UTSW 15 100,872,548 (GRCm39) missense possibly damaging 0.94
R6114:Scn8a UTSW 15 100,938,477 (GRCm39) missense probably damaging 0.99
R6362:Scn8a UTSW 15 100,837,996 (GRCm39) splice site probably null
R6535:Scn8a UTSW 15 100,857,588 (GRCm39) intron probably benign
R6677:Scn8a UTSW 15 100,866,953 (GRCm39) missense probably damaging 1.00
R6687:Scn8a UTSW 15 100,872,508 (GRCm39) missense probably benign 0.12
R6701:Scn8a UTSW 15 100,937,977 (GRCm39) missense probably damaging 1.00
R6719:Scn8a UTSW 15 100,908,896 (GRCm39) critical splice acceptor site probably null
R6739:Scn8a UTSW 15 100,913,836 (GRCm39) missense possibly damaging 0.82
R6769:Scn8a UTSW 15 100,933,445 (GRCm39) missense probably benign
R6786:Scn8a UTSW 15 100,930,096 (GRCm39) missense probably benign 0.00
R6849:Scn8a UTSW 15 100,853,468 (GRCm39) splice site probably null
R7108:Scn8a UTSW 15 100,937,659 (GRCm39) missense probably benign 0.01
R7215:Scn8a UTSW 15 100,927,711 (GRCm39) missense possibly damaging 0.80
R7217:Scn8a UTSW 15 100,868,108 (GRCm39) missense probably benign 0.00
R7219:Scn8a UTSW 15 100,866,984 (GRCm39) missense probably damaging 1.00
R7356:Scn8a UTSW 15 100,855,460 (GRCm39) missense probably damaging 1.00
R7479:Scn8a UTSW 15 100,853,358 (GRCm39) missense probably damaging 0.99
R7816:Scn8a UTSW 15 100,908,917 (GRCm39) missense possibly damaging 0.63
R7985:Scn8a UTSW 15 100,914,843 (GRCm39) splice site probably null
R8112:Scn8a UTSW 15 100,927,718 (GRCm39) missense probably benign 0.27
R8263:Scn8a UTSW 15 100,881,736 (GRCm39) missense probably damaging 1.00
R8305:Scn8a UTSW 15 100,938,387 (GRCm39) missense probably benign 0.01
R8489:Scn8a UTSW 15 100,867,014 (GRCm39) missense probably damaging 1.00
R8983:Scn8a UTSW 15 100,900,030 (GRCm39) missense possibly damaging 0.81
R9034:Scn8a UTSW 15 100,927,642 (GRCm39) missense probably damaging 0.98
R9050:Scn8a UTSW 15 100,906,161 (GRCm39) missense possibly damaging 0.80
R9240:Scn8a UTSW 15 100,915,068 (GRCm39) nonsense probably null
R9249:Scn8a UTSW 15 100,914,456 (GRCm39) missense probably benign 0.00
R9462:Scn8a UTSW 15 100,930,159 (GRCm39) missense
R9599:Scn8a UTSW 15 100,911,172 (GRCm39) missense probably damaging 1.00
R9609:Scn8a UTSW 15 100,834,407 (GRCm39) missense possibly damaging 0.91
R9653:Scn8a UTSW 15 100,937,947 (GRCm39) missense probably damaging 1.00
R9794:Scn8a UTSW 15 100,933,332 (GRCm39) missense probably benign 0.00
X0066:Scn8a UTSW 15 100,937,962 (GRCm39) missense probably damaging 1.00
X0066:Scn8a UTSW 15 100,937,961 (GRCm39) missense probably damaging 1.00
Z1176:Scn8a UTSW 15 100,931,399 (GRCm39) missense probably damaging 1.00
Z1177:Scn8a UTSW 15 100,938,103 (GRCm39) missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CCCCGAAAGGCAGATTAGTGTACC -3'
(R):5'- TGGATAACTGGACACCTACAGCCAC -3'

Sequencing Primer
(F):5'- ccgaagaccaacaggatgag -3'
(R):5'- TACAGCCACAATGAGGAAGTC -3'
Posted On 2013-05-09