Incidental Mutation 'R0254:Scn8a'
Institutional Source Beutler Lab
Gene Symbol Scn8a
Ensembl Gene ENSMUSG00000023033
Gene Namesodium channel, voltage-gated, type VIII, alpha
Synonymsmnd2, C630029C19Rik, nmf58, NMF335, mnd-2, seal, motor end-plate disease, nur14, Nav1.6, med, ataxia 3, nmf2, nmf335, NaCh6
MMRRC Submission 038485-MU
Accession Numbers

Genbank: NM_001077499, NM_011323; MGI: 103169

Is this an essential gene? Probably essential (E-score: 0.799) question?
Stock #R0254 (G1)
Quality Score225
Status Validated
Chromosomal Location100869858-101045938 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 101018364 bp
Amino Acid Change Isoleucine to Asparagine at position 1218 (I1218N)
Ref Sequence ENSEMBL: ENSMUSP00000144371 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000082209] [ENSMUST00000108908] [ENSMUST00000108909] [ENSMUST00000108910] [ENSMUST00000200963] [ENSMUST00000201549]
Predicted Effect probably damaging
Transcript: ENSMUST00000082209
AA Change: I1218N

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000080842
Gene: ENSMUSG00000023033
AA Change: I1218N

Pfam:Ion_trans 131 422 7.4e-82 PFAM
low complexity region 423 452 N/A INTRINSIC
Pfam:Na_trans_cytopl 499 700 3.5e-72 PFAM
low complexity region 701 712 N/A INTRINSIC
Pfam:Ion_trans 750 985 2.2e-57 PFAM
Pfam:Na_trans_assoc 989 1191 2e-59 PFAM
Pfam:Ion_trans 1195 1472 6.2e-69 PFAM
Pfam:Ion_trans 1519 1775 1.2e-56 PFAM
IQ 1892 1914 1.2e-4 SMART
low complexity region 1953 1972 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000108908
AA Change: I1218N

PolyPhen 2 Score 0.964 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000104536
Gene: ENSMUSG00000023033
AA Change: I1218N

Pfam:Ion_trans 72 322 1.9e-76 PFAM
low complexity region 367 378 N/A INTRINSIC
Pfam:Ion_trans 451 640 1.1e-47 PFAM
Pfam:Na_trans_assoc 655 872 1.9e-71 PFAM
Pfam:Ion_trans 898 1127 4.4e-59 PFAM
PDB:1BYY|A 1129 1181 7e-30 PDB
Pfam:Ion_trans 1220 1429 1.9e-51 PFAM
Pfam:PKD_channel 1281 1436 5.6e-7 PFAM
IQ 1558 1580 1.2e-4 SMART
low complexity region 1619 1638 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000108909
AA Change: I1228N

PolyPhen 2 Score 0.282 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000104537
Gene: ENSMUSG00000023033
AA Change: I1228N

Pfam:Ion_trans 72 322 2.2e-76 PFAM
low complexity region 335 364 N/A INTRINSIC
Pfam:DUF3451 390 616 8.7e-70 PFAM
Pfam:Ion_trans 697 886 1.3e-47 PFAM
Pfam:Na_trans_assoc 901 1118 2.3e-71 PFAM
Pfam:Ion_trans 1144 1186 9.7e-10 PFAM
Pfam:Ion_trans 1182 1332 1.7e-31 PFAM
PDB:1BYY|A 1334 1386 2e-29 PDB
Pfam:Ion_trans 1425 1634 2.3e-51 PFAM
Pfam:PKD_channel 1486 1641 6.6e-7 PFAM
IQ 1763 1785 1.2e-4 SMART
low complexity region 1824 1843 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000108910
AA Change: I1218N

PolyPhen 2 Score 0.282 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000104538
Gene: ENSMUSG00000023033
AA Change: I1218N

Pfam:Ion_trans 160 410 2.5e-76 PFAM
low complexity region 423 452 N/A INTRINSIC
Pfam:DUF3451 478 704 9.6e-70 PFAM
Pfam:Ion_trans 785 974 1.4e-47 PFAM
Pfam:Na_trans_assoc 989 1206 2.5e-71 PFAM
Pfam:Ion_trans 1232 1461 5.7e-59 PFAM
PDB:1BYY|A 1463 1515 4e-29 PDB
Pfam:Ion_trans 1554 1763 2.5e-51 PFAM
Pfam:PKD_channel 1615 1770 7.1e-7 PFAM
IQ 1892 1914 1.2e-4 SMART
low complexity region 1953 1972 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000200963
AA Change: I1218N

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000144371
Gene: ENSMUSG00000023033
AA Change: I1218N

Pfam:Ion_trans 131 422 4.1e-80 PFAM
low complexity region 423 452 N/A INTRINSIC
Pfam:Na_trans_cytopl 499 700 2.5e-69 PFAM
low complexity region 701 712 N/A INTRINSIC
Pfam:Ion_trans 750 985 1.2e-55 PFAM
Pfam:Na_trans_assoc 989 1191 9.1e-57 PFAM
Pfam:Ion_trans 1195 1274 7.6e-16 PFAM
Pfam:Ion_trans 1270 1431 2.6e-33 PFAM
Pfam:Ion_trans 1478 1734 6.5e-55 PFAM
IQ 1851 1873 6e-7 SMART
low complexity region 1912 1931 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000201246
Predicted Effect probably damaging
Transcript: ENSMUST00000201549
AA Change: I1218N

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000144013
Gene: ENSMUSG00000023033
AA Change: I1218N

Pfam:Ion_trans 131 422 7.4e-82 PFAM
low complexity region 423 452 N/A INTRINSIC
Pfam:Na_trans_cytopl 499 700 3.5e-72 PFAM
low complexity region 701 712 N/A INTRINSIC
Pfam:Ion_trans 750 985 2.2e-57 PFAM
Pfam:Na_trans_assoc 989 1191 2e-59 PFAM
Pfam:Ion_trans 1195 1472 6.2e-69 PFAM
Pfam:Ion_trans 1519 1775 1.2e-56 PFAM
IQ 1892 1914 1.2e-4 SMART
low complexity region 1953 1972 N/A INTRINSIC
Meta Mutation Damage Score 0.5901 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.1%
  • 20x: 91.7%
Validation Efficiency 100% (100/100)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the sodium channel alpha subunit gene family. The encoded protein forms the ion pore region of the voltage-gated sodium channel. This protein is essential for the rapid membrane depolarization that occurs during the formation of the action potential in excitable neurons. Mutations in this gene are associated with mental retardation, pancerebellar atrophy and ataxia. Alternate splicing results in multiple transcript variants.[provided by RefSeq, May 2010]
PHENOTYPE: Spontaneous mutant homozygotes have ataxia, dystonia, muscular atrophy, progressive paralysis, Purkinje cell loss, in some cases severe head-tossing and for severe alleles, juvenile lethality. A mild, semidominant ENU allele causes deafness of variable penetrance and severity and mild tremor. [provided by MGI curators]
Allele List at MGI

 All alleles(22) : Targeted, knock-out(1) Targeted, other(1) Gene trapped(6) Transgenic(1) Spontaneous(5) Chemically induced(8)

Other mutations in this stock
Total: 97 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700034J05Rik T A 6: 146,952,404 M252L probably benign Het
Abca6 A G 11: 110,236,789 V314A probably benign Het
Abcb1b A T 5: 8,827,409 E656D probably benign Het
Abhd4 T C 14: 54,263,234 I160T probably benign Het
Aco2 T C 15: 81,889,356 V32A probably damaging Het
Actl6b A G 5: 137,554,144 probably benign Het
Akap13 T C 7: 75,736,604 probably benign Het
Alpk3 A T 7: 81,076,974 T136S probably benign Het
Ap1g1 G T 8: 109,803,117 M56I probably benign Het
Arid2 C T 15: 96,370,571 T855I probably damaging Het
Asprv1 T C 6: 86,629,095 F308L probably damaging Het
Ass1 A T 2: 31,514,819 N371Y probably damaging Het
Atp11b T A 3: 35,812,110 M378K possibly damaging Het
Atp1a3 T C 7: 24,981,512 probably benign Het
Blk C A 14: 63,380,804 A218S probably benign Het
C4b T A 17: 34,734,776 T953S probably benign Het
Cdadc1 T C 14: 59,575,907 probably benign Het
Cdca2 C A 14: 67,677,178 L877F probably damaging Het
Ceacam10 G T 7: 24,778,308 V83L probably damaging Het
Cep290 A T 10: 100,514,574 I677F probably benign Het
Clip1 A T 5: 123,617,332 probably benign Het
Col11a2 G T 17: 34,064,803 probably benign Het
Coro1c A T 5: 113,845,252 V405D probably benign Het
Crebrf A G 17: 26,739,594 T13A probably benign Het
Cspg4 A G 9: 56,897,410 E1835G probably damaging Het
Cubn T C 2: 13,424,694 N1332S probably benign Het
Cubn T C 2: 13,440,514 T1014A possibly damaging Het
Cubn A T 2: 13,476,035 probably null Het
Efnb1 T C X: 99,137,028 probably benign Het
Elf2 G T 3: 51,308,190 P33Q probably damaging Het
Fap C T 2: 62,503,402 G633D probably damaging Het
Gm10288 T C 3: 146,838,920 noncoding transcript Het
Gm14139 G A 2: 150,191,864 R35K possibly damaging Het
Gm7714 A T 5: 88,282,371 H42L possibly damaging Het
Got2 T C 8: 95,869,538 N318S probably benign Het
Guk1 A T 11: 59,186,028 F76L probably damaging Het
H2-K1 A T 17: 33,996,665 probably benign Het
Helz2 C A 2: 181,232,759 G1981C probably damaging Het
Hinfp G A 9: 44,298,239 H250Y probably damaging Het
Hnrnpm C T 17: 33,652,268 probably null Het
Hsd11b2 T A 8: 105,523,067 V270E possibly damaging Het
Igbp1b A T 6: 138,658,203 M81K probably damaging Het
Kif11 A G 19: 37,411,509 T815A probably benign Het
Kit G A 5: 75,620,921 V337I probably benign Het
Klf11 T C 12: 24,653,583 S6P probably damaging Het
Klk13 T C 7: 43,723,821 V193A probably benign Het
Krt73 T A 15: 101,799,889 probably benign Het
L1td1 T A 4: 98,737,182 L538* probably null Het
Macf1 A G 4: 123,432,779 L2061P probably damaging Het
Mcm2 A G 6: 88,884,016 I900T probably damaging Het
Med16 A T 10: 79,900,200 N371K possibly damaging Het
Mepce A C 5: 137,785,436 D209E possibly damaging Het
Mrc2 C G 11: 105,347,866 P1249R probably benign Het
Mx2 A T 16: 97,556,095 I463L probably benign Het
Naaa A T 5: 92,265,135 N73K probably damaging Het
Nags T A 11: 102,147,945 L404Q probably damaging Het
Neb A G 2: 52,243,390 Y3379H probably damaging Het
Nhsl1 A G 10: 18,472,985 E120G probably damaging Het
Olfr1276 A C 2: 111,257,121 N2T probably benign Het
Olfr561 C A 7: 102,774,869 S115* probably null Het
Olfr615 T A 7: 103,560,622 Y48* probably null Het
Olfr643 T C 7: 104,059,521 H27R probably benign Het
Olfr736 T C 14: 50,393,079 S108P probably damaging Het
Pcnt A G 10: 76,392,580 F1584L probably benign Het
Pdgfra G A 5: 75,167,935 V243I probably damaging Het
Polr2a T C 11: 69,743,671 I689V possibly damaging Het
Ppfia4 C A 1: 134,324,224 probably benign Het
Prmt8 C A 6: 127,711,808 V200L probably damaging Het
Prpf8 T A 11: 75,506,362 I2007N possibly damaging Het
Ptpn6 T C 6: 124,728,150 E230G probably damaging Het
R3hcc1l G A 19: 42,563,148 V195I probably damaging Het
Rb1cc1 C T 1: 6,262,847 T1330I probably damaging Het
Reep3 G T 10: 67,021,796 T172N probably benign Het
Rfwd3 A G 8: 111,294,023 V236A probably benign Het
Rgs22 T C 15: 36,104,552 I121V probably damaging Het
Robo1 T A 16: 72,664,170 F11I probably benign Het
Rsrc2 A G 5: 123,740,847 probably benign Het
Rubcn A G 16: 32,847,946 V117A probably benign Het
Scamp1 T G 13: 94,210,580 N192T probably benign Het
Serinc1 A G 10: 57,523,208 S200P probably damaging Het
Serpinb9f T A 13: 33,334,591 F358Y probably damaging Het
Slc12a5 T C 2: 164,997,245 probably null Het
Slc5a4b T C 10: 76,070,628 M386V possibly damaging Het
Smarca5 A G 8: 80,704,700 F963L probably benign Het
Smchd1 A T 17: 71,411,891 F828I probably benign Het
Stab2 G T 10: 86,897,960 Q1333K probably benign Het
Svop T C 5: 114,038,539 S349G probably benign Het
Tdrd1 G A 19: 56,842,566 S271N probably benign Het
Tec T C 5: 72,763,556 probably benign Het
Tec G A 5: 72,783,738 P159S probably benign Het
Tfip11 G A 5: 112,335,655 M645I probably benign Het
Thap12 A T 7: 98,715,281 T219S probably benign Het
Tmem87a C T 2: 120,375,507 R329H probably damaging Het
Tpsab1 A G 17: 25,343,745 Y227H probably damaging Het
Urah G A 7: 140,837,689 V114I probably benign Het
Wnt5a G A 14: 28,522,854 E353K probably damaging Het
Zfp101 A T 17: 33,380,978 H601Q possibly damaging Het
Other mutations in Scn8a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00230:Scn8a APN 15 100955532 unclassified probably benign
IGL00979:Scn8a APN 15 100955406 unclassified probably benign
IGL01339:Scn8a APN 15 101032201 missense probably benign
IGL01992:Scn8a APN 15 100969057 missense probably damaging 1.00
IGL02215:Scn8a APN 15 101029572 splice site probably null
IGL02311:Scn8a APN 15 101013283 missense probably damaging 0.97
IGL02404:Scn8a APN 15 101039730 missense probably damaging 1.00
IGL02652:Scn8a APN 15 101013476 missense probably damaging 0.98
IGL02690:Scn8a APN 15 100970254 missense probably damaging 1.00
IGL02704:Scn8a APN 15 101008062 missense possibly damaging 0.94
IGL03084:Scn8a APN 15 101017172 missense probably damaging 1.00
IGL03108:Scn8a APN 15 100974615 missense probably benign
IGL03224:Scn8a APN 15 101035639 missense probably damaging 1.00
dan UTSW 15 101035624 nonsense probably null
nymph UTSW 15 101035646 missense probably damaging 1.00
Tremord UTSW 15 101013504 missense probably damaging 1.00
3-1:Scn8a UTSW 15 101039939 missense probably benign 0.04
PIT4280001:Scn8a UTSW 15 100957489 missense probably damaging 1.00
PIT4508001:Scn8a UTSW 15 101029692 missense probably damaging 0.98
R0010:Scn8a UTSW 15 101013573 missense probably damaging 1.00
R0010:Scn8a UTSW 15 101013573 missense probably damaging 1.00
R0412:Scn8a UTSW 15 101008306 splice site probably benign
R0538:Scn8a UTSW 15 101035624 nonsense probably null
R0539:Scn8a UTSW 15 101016568 missense probably damaging 1.00
R0631:Scn8a UTSW 15 101035537 missense probably damaging 1.00
R0726:Scn8a UTSW 15 100972830 missense probably damaging 1.00
R0945:Scn8a UTSW 15 101015787 missense possibly damaging 0.54
R0967:Scn8a UTSW 15 101035646 missense probably damaging 1.00
R1164:Scn8a UTSW 15 101040162 missense probably benign 0.06
R1283:Scn8a UTSW 15 100969171 missense possibly damaging 0.82
R1368:Scn8a UTSW 15 101035541 missense probably damaging 1.00
R1633:Scn8a UTSW 15 101029815 missense probably benign 0.01
R1669:Scn8a UTSW 15 101011120 missense probably damaging 1.00
R1694:Scn8a UTSW 15 100955528 nonsense probably null
R1735:Scn8a UTSW 15 101015861 missense possibly damaging 0.94
R1773:Scn8a UTSW 15 101039615 missense probably damaging 0.97
R1940:Scn8a UTSW 15 100970204 missense probably benign 0.22
R1996:Scn8a UTSW 15 101024379 missense probably damaging 1.00
R2107:Scn8a UTSW 15 101018363 missense probably damaging 0.99
R2251:Scn8a UTSW 15 101017106 missense probably benign 0.02
R2516:Scn8a UTSW 15 100969162 missense probably benign 0.05
R2917:Scn8a UTSW 15 101039732 missense probably damaging 1.00
R3417:Scn8a UTSW 15 100971668 splice site probably benign
R3896:Scn8a UTSW 15 101035498 missense probably benign
R4024:Scn8a UTSW 15 101039793 missense probably damaging 1.00
R4050:Scn8a UTSW 15 101013413 nonsense probably null
R4193:Scn8a UTSW 15 100971603 missense probably damaging 1.00
R4212:Scn8a UTSW 15 100957073 missense possibly damaging 0.88
R4358:Scn8a UTSW 15 100940133 missense probably benign 0.00
R4396:Scn8a UTSW 15 100972830 missense probably damaging 1.00
R4428:Scn8a UTSW 15 100983903 missense probably damaging 1.00
R4452:Scn8a UTSW 15 100957091 missense possibly damaging 0.95
R4631:Scn8a UTSW 15 101016503 nonsense probably null
R4693:Scn8a UTSW 15 101015691 missense probably damaging 1.00
R4765:Scn8a UTSW 15 101040471 missense probably benign 0.07
R4777:Scn8a UTSW 15 101015951 missense probably damaging 1.00
R4949:Scn8a UTSW 15 101029782 missense probably damaging 1.00
R4997:Scn8a UTSW 15 100957054 missense probably damaging 1.00
R5246:Scn8a UTSW 15 101011057 missense probably damaging 1.00
R5566:Scn8a UTSW 15 100974534 missense probably damaging 1.00
R5875:Scn8a UTSW 15 100972822 nonsense probably null
R6031:Scn8a UTSW 15 100983984 missense probably damaging 1.00
R6031:Scn8a UTSW 15 100983984 missense probably damaging 1.00
R6057:Scn8a UTSW 15 100974667 missense possibly damaging 0.94
R6114:Scn8a UTSW 15 101040596 missense probably damaging 0.99
R6362:Scn8a UTSW 15 100940115 unclassified probably null
R6535:Scn8a UTSW 15 100959707 intron probably benign
R6677:Scn8a UTSW 15 100969072 missense probably damaging 1.00
R6687:Scn8a UTSW 15 100974627 missense probably benign 0.12
R6701:Scn8a UTSW 15 101040096 missense probably damaging 1.00
R6719:Scn8a UTSW 15 101011015 critical splice acceptor site probably null
R6739:Scn8a UTSW 15 101015955 missense possibly damaging 0.82
R6769:Scn8a UTSW 15 101035564 missense probably benign
R6786:Scn8a UTSW 15 101032215 missense probably benign 0.00
R6849:Scn8a UTSW 15 100955587 intron probably null
R7108:Scn8a UTSW 15 101039778 missense probably benign 0.01
R7215:Scn8a UTSW 15 101029830 missense possibly damaging 0.80
R7217:Scn8a UTSW 15 100970227 missense probably benign 0.00
R7219:Scn8a UTSW 15 100969103 missense probably damaging 1.00
R7356:Scn8a UTSW 15 100957579 missense probably damaging 1.00
R7479:Scn8a UTSW 15 100955477 missense probably damaging 0.99
R7816:Scn8a UTSW 15 101011036 missense possibly damaging 0.63
X0066:Scn8a UTSW 15 101040080 missense probably damaging 1.00
X0066:Scn8a UTSW 15 101040081 missense probably damaging 1.00
Z1176:Scn8a UTSW 15 101033518 missense probably damaging 1.00
Z1177:Scn8a UTSW 15 101040222 missense probably benign 0.00
Predicted Primers PCR Primer

Sequencing Primer
(F):5'- ccgaagaccaacaggatgag -3'
Posted On2013-05-09