Incidental Mutation 'R4606:Pik3r2'
ID346022
Institutional Source Beutler Lab
Gene Symbol Pik3r2
Ensembl Gene ENSMUSG00000031834
Gene Namephosphoinositide-3-kinase regulatory subunit 2
Synonymsp85beta
MMRRC Submission 041817-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4606 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location70768176-70776713 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to A at 70772136 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Stop codon at position 199 (R199*)
Ref Sequence ENSEMBL: ENSMUSP00000034296 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034296] [ENSMUST00000143785]
PDB Structure CRYSTAL STRUCTURE OF P110BETA IN COMPLEX WITH ICSH2 OF P85BETA AND THE DRUG GDC-0941 [X-RAY DIFFRACTION]
Predicted Effect probably null
Transcript: ENSMUST00000034296
AA Change: R199*
SMART Domains Protein: ENSMUSP00000034296
Gene: ENSMUSG00000031834
AA Change: R199*

DomainStartEndE-ValueType
SH3 7 79 4e-7 SMART
RhoGAP 122 286 2.36e-18 SMART
low complexity region 291 311 N/A INTRINSIC
SH2 322 405 4.51e-26 SMART
Pfam:PI3K_P85_iSH2 422 590 1.7e-64 PFAM
SH2 614 696 9.96e-28 SMART
low complexity region 713 718 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142370
Predicted Effect probably benign
Transcript: ENSMUST00000143785
SMART Domains Protein: ENSMUSP00000122065
Gene: ENSMUSG00000031834

DomainStartEndE-ValueType
Blast:RhoGAP 1 30 1e-8 BLAST
Pfam:SH2 33 70 4.5e-13 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146707
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152545
Predicted Effect probably benign
Transcript: ENSMUST00000154685
SMART Domains Protein: ENSMUSP00000121463
Gene: ENSMUSG00000031834

DomainStartEndE-ValueType
PDB:2XS6|A 43 84 3e-11 PDB
SCOP:d1pbwa_ 47 79 6e-9 SMART
Blast:RhoGAP 58 84 4e-9 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000191396
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212384
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.0%
Validation Efficiency 96% (69/72)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Phosphatidylinositol 3-kinase (PI3K) is a lipid kinase that phosphorylates phosphatidylinositol and similar compounds, creating second messengers important in growth signaling pathways. PI3K functions as a heterodimer of a regulatory and a catalytic subunit. The protein encoded by this gene is a regulatory component of PI3K. Two transcript variants, one protein coding and the other non-protein coding, have been found for this gene. [provided by RefSeq, Dec 2012]
PHENOTYPE: Mice homozygous for disruptions in this gene have lower blood glucose levels both when fed and after fasting. Insulin sensitivity is improved as well. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700011L22Rik A T 8: 79,210,745 W178R probably benign Het
Abcb5 T C 12: 118,932,610 probably null Het
Akr1b3 C A 6: 34,306,664 probably benign Het
Arid1a A G 4: 133,687,323 F1199S unknown Het
Atp4b A G 8: 13,389,998 F116S probably damaging Het
Atp6v1b1 T C 6: 83,752,461 S127P probably damaging Het
Blk C T 14: 63,374,203 V428I probably benign Het
C87414 A T 5: 93,636,602 D137E probably damaging Het
Ccser1 T C 6: 61,311,584 S244P probably damaging Het
Ceacam1 T A 7: 25,474,526 I235F probably damaging Het
Cyp2g1 T A 7: 26,814,154 Y173N possibly damaging Het
Ddr2 T A 1: 170,001,852 I278F probably benign Het
Degs1 T C 1: 182,276,823 D299G probably damaging Het
Dip2b G A 15: 100,215,329 V1542I possibly damaging Het
Dmxl1 T A 18: 49,962,181 S2942R probably damaging Het
Dpf1 T A 7: 29,316,590 probably benign Het
Ephb6 A G 6: 41,616,574 Y518C probably benign Het
Eps15l1 A T 8: 72,373,916 F606I possibly damaging Het
Extl1 A G 4: 134,371,379 S114P probably damaging Het
Extl1 A C 4: 134,371,380 D113E probably benign Het
Fat1 T C 8: 44,950,683 V157A possibly damaging Het
Fcho1 A T 8: 71,712,480 D444E probably benign Het
Fgd3 T A 13: 49,296,560 D71V probably damaging Het
Fgd5 T A 6: 91,988,209 D316E possibly damaging Het
Gys2 A T 6: 142,454,484 F334I possibly damaging Het
Ik G T 18: 36,753,555 R360L possibly damaging Het
Kazn A C 4: 142,118,288 probably null Het
Kmt2d A T 15: 98,839,716 probably benign Het
Krr1 T C 10: 111,975,677 probably benign Het
Krt83 C T 15: 101,487,049 E389K probably benign Het
Lrrc4c T C 2: 97,630,313 V428A probably benign Het
Lvrn C A 18: 46,864,765 T260K possibly damaging Het
Mcc C T 18: 44,468,421 E614K probably damaging Het
Msrb3 A T 10: 120,849,997 V81D probably damaging Het
Muc19 C T 15: 91,934,383 noncoding transcript Het
Myadm T A 7: 3,297,400 L226* probably null Het
Myof C T 19: 37,967,099 V526M probably damaging Het
Nckap5l A G 15: 99,429,323 probably benign Het
Olfr1010 T A 2: 85,753,940 probably benign Het
Olfr1260 C A 2: 89,978,006 A76D possibly damaging Het
Olfr1270 G T 2: 90,148,816 probably benign Het
Olfr398 A G 11: 73,983,892 S239P probably damaging Het
Pars2 T C 4: 106,654,050 V307A probably benign Het
Pcdhb1 T G 18: 37,265,528 Y177* probably null Het
Pcdhb4 T A 18: 37,308,652 D338E probably damaging Het
Pla2g4f C T 2: 120,313,986 R24Q probably benign Het
Pnma2 T C 14: 66,916,232 I35T probably benign Het
Podn C A 4: 108,017,867 A568S probably benign Het
Pou3f1 A T 4: 124,658,836 E377V probably damaging Het
Ppfia1 T C 7: 144,485,192 D494G probably damaging Het
Ptpn9 A T 9: 57,022,211 T71S possibly damaging Het
Ptprz1 C T 6: 23,001,487 P1192L possibly damaging Het
Rnd2 C T 11: 101,468,999 L57F probably damaging Het
Rnf217 T A 10: 31,517,476 K370* probably null Het
Rpap2 G A 5: 107,601,795 V62I possibly damaging Het
Scaper A T 9: 55,655,903 probably null Het
Sos2 T C 12: 69,614,606 probably benign Het
Sptbn5 C T 2: 120,067,446 probably null Het
Sumo1 A G 1: 59,644,509 probably benign Het
Syne2 C A 12: 75,989,253 N3771K probably damaging Het
Tbx18 T C 9: 87,730,769 I26V possibly damaging Het
Trpm3 T A 19: 22,978,624 M1140K probably benign Het
Usp29 G A 7: 6,963,357 probably null Het
Wdr7 C T 18: 63,779,945 Q946* probably null Het
Ythdf1 T C 2: 180,912,182 D46G probably damaging Het
Zfp217 T C 2: 170,119,750 N219S possibly damaging Het
Zkscan3 A G 13: 21,393,783 I256T probably benign Het
Other mutations in Pik3r2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00487:Pik3r2 APN 8 70770429 missense probably damaging 1.00
IGL01637:Pik3r2 APN 8 70772348 unclassified probably benign
IGL02514:Pik3r2 APN 8 70770592 missense probably benign 0.00
IGL03395:Pik3r2 APN 8 70772355 missense probably benign
kingfisher UTSW 8 70770901 missense probably damaging 1.00
R0022:Pik3r2 UTSW 8 70770901 missense probably damaging 1.00
R0022:Pik3r2 UTSW 8 70770901 missense probably damaging 1.00
R0448:Pik3r2 UTSW 8 70772044 unclassified probably benign
R1636:Pik3r2 UTSW 8 70771898 missense probably benign
R1662:Pik3r2 UTSW 8 70770606 missense probably damaging 1.00
R2114:Pik3r2 UTSW 8 70769385 missense probably benign 0.31
R2879:Pik3r2 UTSW 8 70772385 missense probably benign
R3830:Pik3r2 UTSW 8 70770421 missense probably benign 0.19
R3852:Pik3r2 UTSW 8 70770421 missense probably benign 0.19
R3859:Pik3r2 UTSW 8 70769986 missense probably damaging 1.00
R3967:Pik3r2 UTSW 8 70770421 missense probably benign 0.19
R3968:Pik3r2 UTSW 8 70770421 missense probably benign 0.19
R3969:Pik3r2 UTSW 8 70770421 missense probably benign 0.19
R3970:Pik3r2 UTSW 8 70770421 missense probably benign 0.19
R4666:Pik3r2 UTSW 8 70768859 missense possibly damaging 0.93
R5481:Pik3r2 UTSW 8 70769764 missense probably benign 0.31
R6445:Pik3r2 UTSW 8 70772026 missense probably benign 0.01
R6578:Pik3r2 UTSW 8 70772639 missense probably benign 0.00
R6667:Pik3r2 UTSW 8 70769173 missense probably damaging 1.00
R6794:Pik3r2 UTSW 8 70770717 missense probably benign 0.43
R6863:Pik3r2 UTSW 8 70770414 missense probably damaging 1.00
R7378:Pik3r2 UTSW 8 70769381 missense probably benign 0.03
R7750:Pik3r2 UTSW 8 70770901 missense probably damaging 1.00
R7821:Pik3r2 UTSW 8 70769764 missense probably damaging 1.00
R8056:Pik3r2 UTSW 8 70772367 missense probably benign 0.14
R8237:Pik3r2 UTSW 8 70772150 missense probably benign 0.00
R8414:Pik3r2 UTSW 8 70770435 missense probably damaging 1.00
R8534:Pik3r2 UTSW 8 70774668 missense probably benign
R8781:Pik3r2 UTSW 8 70769402 missense possibly damaging 0.88
R8794:Pik3r2 UTSW 8 70771363 missense probably benign
Predicted Primers PCR Primer
(F):5'- GCATGGACAGCTGTATCTGG -3'
(R):5'- ATTCACCAGGCTGGACTGTG -3'

Sequencing Primer
(F):5'- ACAGCTGTATCTGGCGAGG -3'
(R):5'- GACTGTGATGCGTTGCCATACC -3'
Posted On2015-09-25