Incidental Mutation 'R4606:Fcho1'
ID 346023
Institutional Source Beutler Lab
Gene Symbol Fcho1
Ensembl Gene ENSMUSG00000070000
Gene Name FCH domain only 1
Synonyms 3322402E17Rik
MMRRC Submission 041817-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.259) question?
Stock # R4606 (G1)
Quality Score 225
Status Validated
Chromosome 8
Chromosomal Location 72161031-72178360 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 72165124 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 444 (D444E)
Ref Sequence ENSEMBL: ENSMUSP00000117606 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000093444] [ENSMUST00000125092] [ENSMUST00000136640] [ENSMUST00000146100] [ENSMUST00000153800]
AlphaFold Q8K285
Predicted Effect probably benign
Transcript: ENSMUST00000093444
AA Change: D444E

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000091151
Gene: ENSMUSG00000070000
AA Change: D444E

DomainStartEndE-ValueType
FCH 6 92 2.05e-21 SMART
low complexity region 334 351 N/A INTRINSIC
low complexity region 364 382 N/A INTRINSIC
low complexity region 446 466 N/A INTRINSIC
low complexity region 567 576 N/A INTRINSIC
Pfam:muHD 610 872 4.9e-59 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000123425
SMART Domains Protein: ENSMUSP00000123631
Gene: ENSMUSG00000070000

DomainStartEndE-ValueType
low complexity region 52 70 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000125092
SMART Domains Protein: ENSMUSP00000123554
Gene: ENSMUSG00000070000

DomainStartEndE-ValueType
FCH 6 88 7.62e-16 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126455
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127005
Predicted Effect probably benign
Transcript: ENSMUST00000136640
SMART Domains Protein: ENSMUSP00000119273
Gene: ENSMUSG00000070000

DomainStartEndE-ValueType
FCH 6 92 2.05e-21 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141323
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143699
Predicted Effect probably benign
Transcript: ENSMUST00000146100
AA Change: D444E

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000117606
Gene: ENSMUSG00000070000
AA Change: D444E

DomainStartEndE-ValueType
FCH 6 92 2.05e-21 SMART
low complexity region 334 351 N/A INTRINSIC
low complexity region 364 382 N/A INTRINSIC
low complexity region 446 466 N/A INTRINSIC
low complexity region 567 576 N/A INTRINSIC
Pfam:muHD 610 872 1.4e-62 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149363
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152742
Predicted Effect probably benign
Transcript: ENSMUST00000153800
SMART Domains Protein: ENSMUSP00000116135
Gene: ENSMUSG00000070000

DomainStartEndE-ValueType
FCH 6 92 2.05e-21 SMART
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.0%
Validation Efficiency 96% (69/72)
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700011L22Rik A T 8: 79,937,374 (GRCm39) W178R probably benign Het
Abcb5 T C 12: 118,896,345 (GRCm39) probably null Het
Akr1b1 C A 6: 34,283,599 (GRCm39) probably benign Het
Arid1a A G 4: 133,414,634 (GRCm39) F1199S unknown Het
Atp4b A G 8: 13,439,998 (GRCm39) F116S probably damaging Het
Atp6v1b1 T C 6: 83,729,443 (GRCm39) S127P probably damaging Het
Blk C T 14: 63,611,652 (GRCm39) V428I probably benign Het
Ccser1 T C 6: 61,288,568 (GRCm39) S244P probably damaging Het
Ceacam1 T A 7: 25,173,951 (GRCm39) I235F probably damaging Het
Cyp2g1 T A 7: 26,513,579 (GRCm39) Y173N possibly damaging Het
Ddr2 T A 1: 169,829,421 (GRCm39) I278F probably benign Het
Degs1 T C 1: 182,104,388 (GRCm39) D299G probably damaging Het
Dip2b G A 15: 100,113,210 (GRCm39) V1542I possibly damaging Het
Dmxl1 T A 18: 50,095,248 (GRCm39) S2942R probably damaging Het
Dpf1 T A 7: 29,016,015 (GRCm39) probably benign Het
Ephb6 A G 6: 41,593,508 (GRCm39) Y518C probably benign Het
Eps15l1 A T 8: 73,127,760 (GRCm39) F606I possibly damaging Het
Extl1 A G 4: 134,098,690 (GRCm39) S114P probably damaging Het
Extl1 A C 4: 134,098,691 (GRCm39) D113E probably benign Het
Fat1 T C 8: 45,403,720 (GRCm39) V157A possibly damaging Het
Fgd3 T A 13: 49,450,036 (GRCm39) D71V probably damaging Het
Fgd5 T A 6: 91,965,190 (GRCm39) D316E possibly damaging Het
Gys2 A T 6: 142,400,210 (GRCm39) F334I possibly damaging Het
Ik G T 18: 36,886,608 (GRCm39) R360L possibly damaging Het
Kazn A C 4: 141,845,599 (GRCm39) probably null Het
Kmt2d A T 15: 98,737,597 (GRCm39) probably benign Het
Krr1 T C 10: 111,811,582 (GRCm39) probably benign Het
Krt87 C T 15: 101,384,930 (GRCm39) E389K probably benign Het
Lrrc4c T C 2: 97,460,658 (GRCm39) V428A probably benign Het
Lvrn C A 18: 46,997,832 (GRCm39) T260K possibly damaging Het
Mcc C T 18: 44,601,488 (GRCm39) E614K probably damaging Het
Msrb3 A T 10: 120,685,902 (GRCm39) V81D probably damaging Het
Muc19 C T 15: 91,832,268 (GRCm39) noncoding transcript Het
Myadm T A 7: 3,345,916 (GRCm39) L226* probably null Het
Myof C T 19: 37,955,547 (GRCm39) V526M probably damaging Het
Nckap5l A G 15: 99,327,204 (GRCm39) probably benign Het
Or1r1 A G 11: 73,874,718 (GRCm39) S239P probably damaging Het
Or4b1 G T 2: 89,979,160 (GRCm39) probably benign Het
Or4c35 C A 2: 89,808,350 (GRCm39) A76D possibly damaging Het
Or9g10 T A 2: 85,584,284 (GRCm39) probably benign Het
Pars2 T C 4: 106,511,247 (GRCm39) V307A probably benign Het
Pcdhb1 T G 18: 37,398,581 (GRCm39) Y177* probably null Het
Pcdhb4 T A 18: 37,441,705 (GRCm39) D338E probably damaging Het
Pik3r2 G A 8: 71,224,780 (GRCm39) R199* probably null Het
Pla2g4f C T 2: 120,144,467 (GRCm39) R24Q probably benign Het
Pnma2 T C 14: 67,153,681 (GRCm39) I35T probably benign Het
Podn C A 4: 107,875,064 (GRCm39) A568S probably benign Het
Pou3f1 A T 4: 124,552,629 (GRCm39) E377V probably damaging Het
Ppfia1 T C 7: 144,038,929 (GRCm39) D494G probably damaging Het
Pramel34 A T 5: 93,784,461 (GRCm39) D137E probably damaging Het
Ptpn9 A T 9: 56,929,495 (GRCm39) T71S possibly damaging Het
Ptprz1 C T 6: 23,001,486 (GRCm39) P1192L possibly damaging Het
Rnd2 C T 11: 101,359,825 (GRCm39) L57F probably damaging Het
Rnf217 T A 10: 31,393,472 (GRCm39) K370* probably null Het
Rpap2 G A 5: 107,749,661 (GRCm39) V62I possibly damaging Het
Scaper A T 9: 55,563,187 (GRCm39) probably null Het
Sos2 T C 12: 69,661,380 (GRCm39) probably benign Het
Sptbn5 C T 2: 119,897,927 (GRCm39) probably null Het
Sumo1 A G 1: 59,683,668 (GRCm39) probably benign Het
Syne2 C A 12: 76,036,027 (GRCm39) N3771K probably damaging Het
Tbx18 T C 9: 87,612,822 (GRCm39) I26V possibly damaging Het
Trpm3 T A 19: 22,955,988 (GRCm39) M1140K probably benign Het
Usp29 G A 7: 6,966,356 (GRCm39) probably null Het
Wdr7 C T 18: 63,913,016 (GRCm39) Q946* probably null Het
Ythdf1 T C 2: 180,553,975 (GRCm39) D46G probably damaging Het
Zfp217 T C 2: 169,961,670 (GRCm39) N219S possibly damaging Het
Zkscan3 A G 13: 21,577,953 (GRCm39) I256T probably benign Het
Other mutations in Fcho1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01021:Fcho1 APN 8 72,166,167 (GRCm39) nonsense probably null
IGL01291:Fcho1 APN 8 72,165,191 (GRCm39) missense probably benign 0.08
IGL01473:Fcho1 APN 8 72,164,782 (GRCm39) missense probably benign 0.03
IGL02021:Fcho1 APN 8 72,173,919 (GRCm39) missense probably benign 0.06
IGL02086:Fcho1 APN 8 72,169,444 (GRCm39) missense probably damaging 1.00
IGL02808:Fcho1 APN 8 72,165,185 (GRCm39) missense possibly damaging 0.89
IGL03146:Fcho1 APN 8 72,170,074 (GRCm39) splice site probably benign
IGL03267:Fcho1 APN 8 72,164,943 (GRCm39) unclassified probably benign
cameo UTSW 8 72,169,507 (GRCm39) missense possibly damaging 0.92
Lesser UTSW 8 72,165,204 (GRCm39) missense probably benign 0.00
Sidekick UTSW 8 72,168,369 (GRCm39) missense probably damaging 1.00
ANU05:Fcho1 UTSW 8 72,165,191 (GRCm39) missense probably benign 0.08
R0003:Fcho1 UTSW 8 72,161,597 (GRCm39) missense probably damaging 1.00
R0010:Fcho1 UTSW 8 72,162,643 (GRCm39) missense probably damaging 1.00
R0020:Fcho1 UTSW 8 72,169,514 (GRCm39) missense probably benign 0.11
R0363:Fcho1 UTSW 8 72,170,134 (GRCm39) missense probably damaging 1.00
R0457:Fcho1 UTSW 8 72,165,204 (GRCm39) missense probably benign 0.00
R0485:Fcho1 UTSW 8 72,165,204 (GRCm39) missense probably benign 0.00
R0501:Fcho1 UTSW 8 72,165,204 (GRCm39) missense probably benign 0.00
R0502:Fcho1 UTSW 8 72,165,204 (GRCm39) missense probably benign 0.00
R0551:Fcho1 UTSW 8 72,164,818 (GRCm39) missense probably benign 0.06
R0583:Fcho1 UTSW 8 72,168,369 (GRCm39) missense probably damaging 1.00
R0584:Fcho1 UTSW 8 72,168,369 (GRCm39) missense probably damaging 1.00
R0585:Fcho1 UTSW 8 72,168,369 (GRCm39) missense probably damaging 1.00
R0612:Fcho1 UTSW 8 72,168,168 (GRCm39) missense probably damaging 1.00
R0614:Fcho1 UTSW 8 72,165,204 (GRCm39) missense probably benign 0.00
R0647:Fcho1 UTSW 8 72,165,204 (GRCm39) missense probably benign 0.00
R0841:Fcho1 UTSW 8 72,165,204 (GRCm39) missense probably benign 0.00
R0842:Fcho1 UTSW 8 72,165,204 (GRCm39) missense probably benign 0.00
R1034:Fcho1 UTSW 8 72,165,204 (GRCm39) missense probably benign 0.00
R1036:Fcho1 UTSW 8 72,165,204 (GRCm39) missense probably benign 0.00
R1399:Fcho1 UTSW 8 72,165,204 (GRCm39) missense probably benign 0.00
R1466:Fcho1 UTSW 8 72,165,204 (GRCm39) missense probably benign 0.00
R1466:Fcho1 UTSW 8 72,165,204 (GRCm39) missense probably benign 0.00
R1618:Fcho1 UTSW 8 72,163,047 (GRCm39) missense probably damaging 0.98
R1754:Fcho1 UTSW 8 72,163,890 (GRCm39) missense probably benign
R1793:Fcho1 UTSW 8 72,161,666 (GRCm39) nonsense probably null
R2073:Fcho1 UTSW 8 72,163,133 (GRCm39) missense probably damaging 0.98
R2177:Fcho1 UTSW 8 72,164,905 (GRCm39) missense probably damaging 1.00
R4072:Fcho1 UTSW 8 72,163,013 (GRCm39) missense probably damaging 0.99
R4074:Fcho1 UTSW 8 72,163,013 (GRCm39) missense probably damaging 0.99
R4076:Fcho1 UTSW 8 72,163,013 (GRCm39) missense probably damaging 0.99
R4732:Fcho1 UTSW 8 72,169,439 (GRCm39) missense probably benign 0.00
R4733:Fcho1 UTSW 8 72,169,439 (GRCm39) missense probably benign 0.00
R4860:Fcho1 UTSW 8 72,163,125 (GRCm39) missense probably benign 0.04
R4860:Fcho1 UTSW 8 72,163,125 (GRCm39) missense probably benign 0.04
R5082:Fcho1 UTSW 8 72,169,829 (GRCm39) missense possibly damaging 0.69
R5083:Fcho1 UTSW 8 72,169,820 (GRCm39) missense probably benign 0.00
R5185:Fcho1 UTSW 8 72,167,600 (GRCm39) unclassified probably benign
R6025:Fcho1 UTSW 8 72,165,217 (GRCm39) splice site probably null
R6624:Fcho1 UTSW 8 72,162,015 (GRCm39) missense probably damaging 0.99
R6875:Fcho1 UTSW 8 72,167,069 (GRCm39) splice site probably null
R7069:Fcho1 UTSW 8 72,163,141 (GRCm39) splice site probably null
R7476:Fcho1 UTSW 8 72,166,190 (GRCm39) missense probably damaging 1.00
R7512:Fcho1 UTSW 8 72,169,507 (GRCm39) missense possibly damaging 0.92
R7951:Fcho1 UTSW 8 72,164,920 (GRCm39) missense probably benign 0.00
R8699:Fcho1 UTSW 8 72,162,277 (GRCm39) missense possibly damaging 0.63
R8938:Fcho1 UTSW 8 72,169,790 (GRCm39) missense possibly damaging 0.96
R9090:Fcho1 UTSW 8 72,163,068 (GRCm39) missense possibly damaging 0.80
R9117:Fcho1 UTSW 8 72,164,712 (GRCm39) missense possibly damaging 0.87
R9119:Fcho1 UTSW 8 72,164,712 (GRCm39) missense possibly damaging 0.87
R9271:Fcho1 UTSW 8 72,163,068 (GRCm39) missense possibly damaging 0.80
R9433:Fcho1 UTSW 8 72,169,468 (GRCm39) missense probably benign 0.03
R9447:Fcho1 UTSW 8 72,169,913 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCAGAGGTCACCGTAGTCCATG -3'
(R):5'- GATGTGGCCATGCTGCATAG -3'

Sequencing Primer
(F):5'- GTCACCGTAGTCCATGCCTAG -3'
(R):5'- TCCTGGGGGAAGATGTAACTAC -3'
Posted On 2015-09-25