Mutagenetix > Incidental Mutation

Incidental Mutation 'R4606:Scaper'

346026

Institutional Source

Beutler Lab

Gene Symbol

Scaper

Ensembl Gene

ENSMUSG00000034007

Gene Name

S phase cyclin A-associated protein in the ER

Synonyms

D530014O03Rik, Zfp291

MMRRC Submission

041817-MU

Accession Numbers

Essential gene?

Possibly essential (E-score: 0.654) question?

Stock #

R4606 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

55549879-55938119 bp(-) (GRCm38)

Type of Mutation

critical splice donor site (2 bp from exon)

DNA Base Change (assembly)

A to T at 55655903 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000149750 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000037408] [ENSMUST00000037408] [ENSMUST00000214747] [ENSMUST00000216595] [ENSMUST00000217647]

AlphaFold

F8VQ70

Predicted Effect

probably null
Transcript: ENSMUST00000037408

SMART Domains

Protein: ENSMUSP00000043411
Gene: ENSMUSG00000034007

Domain	Start	End	E-Value	Type
Pfam:SCAPER_N	88	185	3.4e-47	PFAM
low complexity region	323	338	N/A	INTRINSIC
coiled coil region	415	466	N/A	INTRINSIC
coiled coil region	535	597	N/A	INTRINSIC
SCOP:d1eq1a_	605	769	3e-6	SMART
ZnF_C2H2	791	815	1.16e1	SMART
low complexity region	866	883	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000037408

SMART Domains

Protein: ENSMUSP00000043411
Gene: ENSMUSG00000034007

Domain	Start	End	E-Value	Type
Pfam:SCAPER_N	88	185	3.4e-47	PFAM
low complexity region	323	338	N/A	INTRINSIC
coiled coil region	415	466	N/A	INTRINSIC
coiled coil region	535	597	N/A	INTRINSIC
SCOP:d1eq1a_	605	769	3e-6	SMART
ZnF_C2H2	791	815	1.16e1	SMART
low complexity region	866	883	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000214747

Predicted Effect

probably null
Transcript: ENSMUST00000216595

Predicted Effect

probably null
Transcript: ENSMUST00000217647

Meta Mutation Damage Score

0.9481

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.2%
20x: 95.0%

Validation Efficiency

96% (69/72)

Allele List at MGI

Other mutations in this stock

Total: 67 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700011L22Rik	A	T	8: 79,210,745	W178R	probably benign	Het
Abcb5	T	C	12: 118,932,610		probably null	Het
Akr1b3	C	A	6: 34,306,664		probably benign	Het
Arid1a	A	G	4: 133,687,323	F1199S	unknown	Het
Atp4b	A	G	8: 13,389,998	F116S	probably damaging	Het
Atp6v1b1	T	C	6: 83,752,461	S127P	probably damaging	Het
Blk	C	T	14: 63,374,203	V428I	probably benign	Het
C87414	A	T	5: 93,636,602	D137E	probably damaging	Het
Ccser1	T	C	6: 61,311,584	S244P	probably damaging	Het
Ceacam1	T	A	7: 25,474,526	I235F	probably damaging	Het
Cyp2g1	T	A	7: 26,814,154	Y173N	possibly damaging	Het
Ddr2	T	A	1: 170,001,852	I278F	probably benign	Het
Degs1	T	C	1: 182,276,823	D299G	probably damaging	Het
Dip2b	G	A	15: 100,215,329	V1542I	possibly damaging	Het
Dmxl1	T	A	18: 49,962,181	S2942R	probably damaging	Het
Dpf1	T	A	7: 29,316,590		probably benign	Het
Ephb6	A	G	6: 41,616,574	Y518C	probably benign	Het
Eps15l1	A	T	8: 72,373,916	F606I	possibly damaging	Het
Extl1	A	G	4: 134,371,379	S114P	probably damaging	Het
Extl1	A	C	4: 134,371,380	D113E	probably benign	Het
Fat1	T	C	8: 44,950,683	V157A	possibly damaging	Het
Fcho1	A	T	8: 71,712,480	D444E	probably benign	Het
Fgd3	T	A	13: 49,296,560	D71V	probably damaging	Het
Fgd5	T	A	6: 91,988,209	D316E	possibly damaging	Het
Gys2	A	T	6: 142,454,484	F334I	possibly damaging	Het
Ik	G	T	18: 36,753,555	R360L	possibly damaging	Het
Kazn	A	C	4: 142,118,288		probably null	Het
Kmt2d	A	T	15: 98,839,716		probably benign	Het
Krr1	T	C	10: 111,975,677		probably benign	Het
Krt83	C	T	15: 101,487,049	E389K	probably benign	Het
Lrrc4c	T	C	2: 97,630,313	V428A	probably benign	Het
Lvrn	C	A	18: 46,864,765	T260K	possibly damaging	Het
Mcc	C	T	18: 44,468,421	E614K	probably damaging	Het
Msrb3	A	T	10: 120,849,997	V81D	probably damaging	Het
Muc19	C	T	15: 91,934,383		noncoding transcript	Het
Myadm	T	A	7: 3,297,400	L226*	probably null	Het
Myof	C	T	19: 37,967,099	V526M	probably damaging	Het
Nckap5l	A	G	15: 99,429,323		probably benign	Het
Olfr1010	T	A	2: 85,753,940		probably benign	Het
Olfr1260	C	A	2: 89,978,006	A76D	possibly damaging	Het
Olfr1270	G	T	2: 90,148,816		probably benign	Het
Olfr398	A	G	11: 73,983,892	S239P	probably damaging	Het
Pars2	T	C	4: 106,654,050	V307A	probably benign	Het
Pcdhb1	T	G	18: 37,265,528	Y177*	probably null	Het
Pcdhb4	T	A	18: 37,308,652	D338E	probably damaging	Het
Pik3r2	G	A	8: 70,772,136	R199*	probably null	Het
Pla2g4f	C	T	2: 120,313,986	R24Q	probably benign	Het
Pnma2	T	C	14: 66,916,232	I35T	probably benign	Het
Podn	C	A	4: 108,017,867	A568S	probably benign	Het
Pou3f1	A	T	4: 124,658,836	E377V	probably damaging	Het
Ppfia1	T	C	7: 144,485,192	D494G	probably damaging	Het
Ptpn9	A	T	9: 57,022,211	T71S	possibly damaging	Het
Ptprz1	C	T	6: 23,001,487	P1192L	possibly damaging	Het
Rnd2	C	T	11: 101,468,999	L57F	probably damaging	Het
Rnf217	T	A	10: 31,517,476	K370*	probably null	Het
Rpap2	G	A	5: 107,601,795	V62I	possibly damaging	Het
Sos2	T	C	12: 69,614,606		probably benign	Het
Sptbn5	C	T	2: 120,067,446		probably null	Het
Sumo1	A	G	1: 59,644,509		probably benign	Het
Syne2	C	A	12: 75,989,253	N3771K	probably damaging	Het
Tbx18	T	C	9: 87,730,769	I26V	possibly damaging	Het
Trpm3	T	A	19: 22,978,624	M1140K	probably benign	Het
Usp29	G	A	7: 6,963,357		probably null	Het
Wdr7	C	T	18: 63,779,945	Q946*	probably null	Het
Ythdf1	T	C	2: 180,912,182	D46G	probably damaging	Het
Zfp217	T	C	2: 170,119,750	N219S	possibly damaging	Het
Zkscan3	A	G	13: 21,393,783	I256T	probably benign	Het

Other mutations in Scaper

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00653:Scaper	APN	9	55859859	missense	probably damaging	0.99
IGL00912:Scaper	APN	9	55685955	missense	probably damaging	1.00
IGL01469:Scaper	APN	9	55859767	missense	probably damaging	1.00
IGL01626:Scaper	APN	9	55912051	missense	possibly damaging	0.61
IGL01779:Scaper	APN	9	55892240	missense	probably benign	0.20
IGL02011:Scaper	APN	9	55580322	missense	probably damaging	1.00
IGL02997:Scaper	APN	9	55815499	missense	probably damaging	1.00
IGL03107:Scaper	APN	9	55858402	splice site	probably benign
IGL03167:Scaper	APN	9	55859824	missense	probably damaging	1.00
IGL03293:Scaper	APN	9	55874823	missense	probably benign
IGL03340:Scaper	APN	9	55602832	missense	possibly damaging	0.88
IGL03368:Scaper	APN	9	55656027	missense	possibly damaging	0.53
R0111:Scaper	UTSW	9	55602790	missense	probably benign	0.01
R0510:Scaper	UTSW	9	55758062	splice site	probably benign
R0531:Scaper	UTSW	9	55609874	missense	possibly damaging	0.91
R0558:Scaper	UTSW	9	55685923	missense	probably benign	0.08
R0605:Scaper	UTSW	9	55815518	splice site	probably benign
R0646:Scaper	UTSW	9	55758056	missense	probably damaging	1.00
R0837:Scaper	UTSW	9	55859042	nonsense	probably null
R1440:Scaper	UTSW	9	55602918	nonsense	probably null
R1548:Scaper	UTSW	9	55816670	missense	probably damaging	1.00
R1777:Scaper	UTSW	9	55864546	missense	probably benign	0.33
R1822:Scaper	UTSW	9	55859900	missense	probably damaging	0.99
R1834:Scaper	UTSW	9	55816734	missense	possibly damaging	0.90
R1870:Scaper	UTSW	9	55685938	missense	probably damaging	1.00
R2102:Scaper	UTSW	9	55912050	missense	probably benign	0.43
R2168:Scaper	UTSW	9	55743639	missense	probably damaging	1.00
R2174:Scaper	UTSW	9	55859037	missense	probably null	0.01
R3690:Scaper	UTSW	9	55883921	missense	probably benign	0.00
R4392:Scaper	UTSW	9	55858115	missense	probably damaging	0.99
R4418:Scaper	UTSW	9	55838180	missense	probably damaging	1.00
R4643:Scaper	UTSW	9	55838179	missense	probably damaging	0.99
R4665:Scaper	UTSW	9	55912055	missense	probably damaging	1.00
R4739:Scaper	UTSW	9	55743648	missense	probably damaging	1.00
R4921:Scaper	UTSW	9	55892235	missense	probably benign	0.02
R4934:Scaper	UTSW	9	55809175	missense	probably damaging	1.00
R4956:Scaper	UTSW	9	55838142	missense	probably damaging	1.00
R5055:Scaper	UTSW	9	55859719	splice site	probably null
R5107:Scaper	UTSW	9	55580332	missense	probably damaging	1.00
R5155:Scaper	UTSW	9	55556086	missense	probably null	1.00
R5265:Scaper	UTSW	9	55864546	missense	probably benign
R5408:Scaper	UTSW	9	55586224	missense	probably damaging	0.99
R5623:Scaper	UTSW	9	55864507	missense	probably benign	0.02
R5665:Scaper	UTSW	9	55807632	missense	probably damaging	1.00
R5748:Scaper	UTSW	9	55859076	critical splice acceptor site	probably null
R5771:Scaper	UTSW	9	55816791	missense	probably damaging	1.00
R6534:Scaper	UTSW	9	55883976	missense	probably benign	0.00
R6557:Scaper	UTSW	9	55550850	missense	probably benign	0.02
R6651:Scaper	UTSW	9	55858504	missense	probably benign	0.05
R6796:Scaper	UTSW	9	55864427	missense	probably benign	0.00
R6962:Scaper	UTSW	9	55859771	missense	probably benign	0.01
R7145:Scaper	UTSW	9	55912111	missense	unknown
R7199:Scaper	UTSW	9	55838176	nonsense	probably null
R7356:Scaper	UTSW	9	55892211	missense	unknown
R7426:Scaper	UTSW	9	55762277	nonsense	probably null
R7503:Scaper	UTSW	9	55807754	missense	probably damaging	0.98
R7844:Scaper	UTSW	9	55815448	missense	probably benign	0.04
R7966:Scaper	UTSW	9	55762327	missense	probably damaging	0.98
R7992:Scaper	UTSW	9	55858154	missense	probably benign	0.02
R8081:Scaper	UTSW	9	55916046	missense	unknown
R8189:Scaper	UTSW	9	55912120	missense	probably damaging	1.00
R8294:Scaper	UTSW	9	55609996	missense	possibly damaging	0.62
R8351:Scaper	UTSW	9	55816804	missense	possibly damaging	0.92
R8451:Scaper	UTSW	9	55816804	missense	possibly damaging	0.92
R8473:Scaper	UTSW	9	55550847	missense	probably damaging	1.00
R8476:Scaper	UTSW	9	55762291	missense	probably damaging	1.00
R8504:Scaper	UTSW	9	55864438	missense	probably benign
R9058:Scaper	UTSW	9	55815478	missense	probably damaging	1.00
R9071:Scaper	UTSW	9	55864519	missense	probably benign
R9099:Scaper	UTSW	9	55762332	missense	probably damaging	0.98
R9104:Scaper	UTSW	9	55912116	missense	unknown
R9516:Scaper	UTSW	9	55685991	missense	probably benign	0.05
R9685:Scaper	UTSW	9	55864551	missense	probably benign	0.10
X0012:Scaper	UTSW	9	55655930	missense	probably damaging	0.98
X0052:Scaper	UTSW	9	55816664	missense	probably damaging	1.00
Z1176:Scaper	UTSW	9	55556248	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TGAGAGATTTCACTTCCAGTTCC -3'
(R):5'- TAGACTAGCTTCCATCTCATGC -3'

Sequencing Primer
(F):5'- AGAGATTTCACTTCCAGTTCCTATTG -3'
(R):5'- TTAAACTGTTGGGAGAATAGTTGC -3'

Posted On

2015-09-25