Mutagenetix > Incidental Mutations

Incidental Mutation 'R0254:Robo1'

34604

Institutional Source

Beutler Lab

Gene Symbol

Robo1

Ensembl Gene

ENSMUSG00000022883

Gene Name

roundabout guidance receptor 1

Synonyms

DUTT1

MMRRC Submission

038485-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R0254 (G1)

Quality Score

215

Status

Validated

Chromosome

Chromosomal Location

72308306-73046095 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 72664170 bp

Zygosity

Heterozygous

Amino Acid Change

Phenylalanine to Isoleucine at position 11 (F11I)

Ref Sequence

ENSEMBL: ENSMUSP00000023600 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000023600] [ENSMUST00000231580]

Predicted Effect

probably benign
Transcript: ENSMUST00000023600
AA Change: F11I

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000023600
Gene: ENSMUSG00000022883
AA Change: F11I

Domain	Start	End	E-Value	Type
IGc2	41	115	3.15e-10	SMART
IGc2	143	208	2.52e-9	SMART
IGc2	235	298	3.85e-14	SMART
IGv	328	391	3.71e-7	SMART
IGc2	428	493	2.46e-12	SMART
FN3	522	604	3.17e-13	SMART
FN3	634	721	1.66e0	SMART
FN3	736	822	4.28e-10	SMART
low complexity region	1108	1125	N/A	INTRINSIC
low complexity region	1148	1157	N/A	INTRINSIC
low complexity region	1186	1197	N/A	INTRINSIC
low complexity region	1249	1269	N/A	INTRINSIC
low complexity region	1282	1298	N/A	INTRINSIC
low complexity region	1345	1357	N/A	INTRINSIC
low complexity region	1362	1380	N/A	INTRINSIC
low complexity region	1442	1449	N/A	INTRINSIC
low complexity region	1563	1576	N/A	INTRINSIC
low complexity region	1602	1611	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000231265

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000231474

Predicted Effect

probably benign
Transcript: ENSMUST00000231580

Predicted Effect

probably benign
Transcript: ENSMUST00000232205

Meta Mutation Damage Score

0.0668

Coding Region Coverage

1x: 99.1%
3x: 98.3%
10x: 96.1%
20x: 91.7%

Validation Efficiency

100% (100/100)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Bilateral symmetric nervous systems have special midline structures that establish a partition between the two mirror image halves. Some axons project toward and across the midline in response to long-range chemoattractants emanating from the midline. The product of this gene is a member of the immunoglobulin gene superfamily and encodes an integral membrane protein that functions in axon guidance and neuronal precursor cell migration. This receptor is activated by SLIT-family proteins, resulting in a repulsive effect on glioma cell guidance in the developing brain. A related gene is located at an adjacent region on chromosome 3. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Mar 2009]
PHENOTYPE: Mice homozygous for a reporter allele show altered axon guidance. Mice homozygous for a null allele die at birth showing aberrant axon pathfinding and cortical interneuron migration. Homozygotes for another null allele show neonatal death, aphagia, delayed lung maturation and bronchial hyperplasia. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 97 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700034J05Rik	T	A	6: 146,952,404	M252L	probably benign	Het
Abca6	A	G	11: 110,236,789	V314A	probably benign	Het
Abcb1b	A	T	5: 8,827,409	E656D	probably benign	Het
Abhd4	T	C	14: 54,263,234	I160T	probably benign	Het
Aco2	T	C	15: 81,889,356	V32A	probably damaging	Het
Actl6b	A	G	5: 137,554,144		probably benign	Het
Akap13	T	C	7: 75,736,604		probably benign	Het
Alpk3	A	T	7: 81,076,974	T136S	probably benign	Het
Ap1g1	G	T	8: 109,803,117	M56I	probably benign	Het
Arid2	C	T	15: 96,370,571	T855I	probably damaging	Het
Asprv1	T	C	6: 86,629,095	F308L	probably damaging	Het
Ass1	A	T	2: 31,514,819	N371Y	probably damaging	Het
Atp11b	T	A	3: 35,812,110	M378K	possibly damaging	Het
Atp1a3	T	C	7: 24,981,512		probably benign	Het
Blk	C	A	14: 63,380,804	A218S	probably benign	Het
C4b	T	A	17: 34,734,776	T953S	probably benign	Het
Cdadc1	T	C	14: 59,575,907		probably benign	Het
Cdca2	C	A	14: 67,677,178	L877F	probably damaging	Het
Ceacam10	G	T	7: 24,778,308	V83L	probably damaging	Het
Cep290	A	T	10: 100,514,574	I677F	probably benign	Het
Clip1	A	T	5: 123,617,332		probably benign	Het
Col11a2	G	T	17: 34,064,803		probably benign	Het
Coro1c	A	T	5: 113,845,252	V405D	probably benign	Het
Crebrf	A	G	17: 26,739,594	T13A	probably benign	Het
Cspg4	A	G	9: 56,897,410	E1835G	probably damaging	Het
Cubn	T	C	2: 13,424,694	N1332S	probably benign	Het
Cubn	T	C	2: 13,440,514	T1014A	possibly damaging	Het
Cubn	A	T	2: 13,476,035		probably null	Het
Efnb1	T	C	X: 99,137,028		probably benign	Het
Elf2	G	T	3: 51,308,190	P33Q	probably damaging	Het
Fap	C	T	2: 62,503,402	G633D	probably damaging	Het
Gm10288	T	C	3: 146,838,920		noncoding transcript	Het
Gm14139	G	A	2: 150,191,864	R35K	possibly damaging	Het
Gm7714	A	T	5: 88,282,371	H42L	possibly damaging	Het
Got2	T	C	8: 95,869,538	N318S	probably benign	Het
Guk1	A	T	11: 59,186,028	F76L	probably damaging	Het
H2-K1	A	T	17: 33,996,665		probably benign	Het
Helz2	C	A	2: 181,232,759	G1981C	probably damaging	Het
Hinfp	G	A	9: 44,298,239	H250Y	probably damaging	Het
Hnrnpm	C	T	17: 33,652,268		probably null	Het
Hsd11b2	T	A	8: 105,523,067	V270E	possibly damaging	Het
Igbp1b	A	T	6: 138,658,203	M81K	probably damaging	Het
Kif11	A	G	19: 37,411,509	T815A	probably benign	Het
Kit	G	A	5: 75,620,921	V337I	probably benign	Het
Klf11	T	C	12: 24,653,583	S6P	probably damaging	Het
Klk13	T	C	7: 43,723,821	V193A	probably benign	Het
Krt73	T	A	15: 101,799,889		probably benign	Het
L1td1	T	A	4: 98,737,182	L538*	probably null	Het
Macf1	A	G	4: 123,432,779	L2061P	probably damaging	Het
Mcm2	A	G	6: 88,884,016	I900T	probably damaging	Het
Med16	A	T	10: 79,900,200	N371K	possibly damaging	Het
Mepce	A	C	5: 137,785,436	D209E	possibly damaging	Het
Mrc2	C	G	11: 105,347,866	P1249R	probably benign	Het
Mx2	A	T	16: 97,556,095	I463L	probably benign	Het
Naaa	A	T	5: 92,265,135	N73K	probably damaging	Het
Nags	T	A	11: 102,147,945	L404Q	probably damaging	Het
Neb	A	G	2: 52,243,390	Y3379H	probably damaging	Het
Nhsl1	A	G	10: 18,472,985	E120G	probably damaging	Het
Olfr1276	A	C	2: 111,257,121	N2T	probably benign	Het
Olfr561	C	A	7: 102,774,869	S115*	probably null	Het
Olfr615	T	A	7: 103,560,622	Y48*	probably null	Het
Olfr643	T	C	7: 104,059,521	H27R	probably benign	Het
Olfr736	T	C	14: 50,393,079	S108P	probably damaging	Het
Pcnt	A	G	10: 76,392,580	F1584L	probably benign	Het
Pdgfra	G	A	5: 75,167,935	V243I	probably damaging	Het
Polr2a	T	C	11: 69,743,671	I689V	possibly damaging	Het
Ppfia4	C	A	1: 134,324,224		probably benign	Het
Prmt8	C	A	6: 127,711,808	V200L	probably damaging	Het
Prpf8	T	A	11: 75,506,362	I2007N	possibly damaging	Het
Ptpn6	T	C	6: 124,728,150	E230G	probably damaging	Het
R3hcc1l	G	A	19: 42,563,148	V195I	probably damaging	Het
Rb1cc1	C	T	1: 6,262,847	T1330I	probably damaging	Het
Reep3	G	T	10: 67,021,796	T172N	probably benign	Het
Rfwd3	A	G	8: 111,294,023	V236A	probably benign	Het
Rgs22	T	C	15: 36,104,552	I121V	probably damaging	Het
Rsrc2	A	G	5: 123,740,847		probably benign	Het
Rubcn	A	G	16: 32,847,946	V117A	probably benign	Het
Scamp1	T	G	13: 94,210,580	N192T	probably benign	Het
Scn8a	T	A	15: 101,018,364	I1218N	probably damaging	Het
Serinc1	A	G	10: 57,523,208	S200P	probably damaging	Het
Serpinb9f	T	A	13: 33,334,591	F358Y	probably damaging	Het
Slc12a5	T	C	2: 164,997,245		probably null	Het
Slc5a4b	T	C	10: 76,070,628	M386V	possibly damaging	Het
Smarca5	A	G	8: 80,704,700	F963L	probably benign	Het
Smchd1	A	T	17: 71,411,891	F828I	probably benign	Het
Stab2	G	T	10: 86,897,960	Q1333K	probably benign	Het
Svop	T	C	5: 114,038,539	S349G	probably benign	Het
Tdrd1	G	A	19: 56,842,566	S271N	probably benign	Het
Tec	T	C	5: 72,763,556		probably benign	Het
Tec	G	A	5: 72,783,738	P159S	probably benign	Het
Tfip11	G	A	5: 112,335,655	M645I	probably benign	Het
Thap12	A	T	7: 98,715,281	T219S	probably benign	Het
Tmem87a	C	T	2: 120,375,507	R329H	probably damaging	Het
Tpsab1	A	G	17: 25,343,745	Y227H	probably damaging	Het
Urah	G	A	7: 140,837,689	V114I	probably benign	Het
Wnt5a	G	A	14: 28,522,854	E353K	probably damaging	Het
Zfp101	A	T	17: 33,380,978	H601Q	possibly damaging	Het

Other mutations in Robo1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01766:Robo1	APN	16	73004665	missense	probably benign	0.00
IGL01937:Robo1	APN	16	72962226	missense	probably damaging	1.00
IGL01945:Robo1	APN	16	72962226	missense	probably damaging	1.00
IGL02151:Robo1	APN	16	72989616	missense	probably benign	0.00
IGL02232:Robo1	APN	16	72971984	missense	possibly damaging	0.59
IGL02282:Robo1	APN	16	72742138	missense	probably damaging	1.00
IGL02590:Robo1	APN	16	73043132	missense	probably benign	0.06
IGL02874:Robo1	APN	16	73012918	missense	probably damaging	0.96
IGL02974:Robo1	APN	16	73006862	missense	probably benign	0.09
IGL03233:Robo1	APN	16	72970193	missense	probably damaging	0.99
PIT4378001:Robo1	UTSW	16	73004535	missense	probably damaging	1.00
R0079:Robo1	UTSW	16	72933342	splice site	probably benign
R0366:Robo1	UTSW	16	72742245	missense	possibly damaging	0.52
R0410:Robo1	UTSW	16	72971984	missense	possibly damaging	0.59
R0511:Robo1	UTSW	16	73013125	critical splice donor site	probably null
R0563:Robo1	UTSW	16	72972286	missense	probably benign	0.01
R0637:Robo1	UTSW	16	73001951	missense	probably benign	0.29
R1239:Robo1	UTSW	16	73024542	splice site	probably null
R1773:Robo1	UTSW	16	73004511	missense	probably benign	0.00
R1777:Robo1	UTSW	16	73004667	missense	probably benign
R1901:Robo1	UTSW	16	72960204	missense	probably null	1.00
R1902:Robo1	UTSW	16	72960204	missense	probably null	1.00
R1903:Robo1	UTSW	16	72960204	missense	probably null	1.00
R1996:Robo1	UTSW	16	72970179	missense	probably benign	0.40
R2040:Robo1	UTSW	16	72933742	missense	probably damaging	1.00
R2266:Robo1	UTSW	16	72978772	missense	probably benign
R2269:Robo1	UTSW	16	72978772	missense	probably benign
R2433:Robo1	UTSW	16	72970239	missense	probably benign	0.01
R3084:Robo1	UTSW	16	73004737	missense	probably benign	0.02
R3085:Robo1	UTSW	16	73002010	missense	possibly damaging	0.81
R3150:Robo1	UTSW	16	72970269	missense	possibly damaging	0.57
R3418:Robo1	UTSW	16	73035917	missense	probably benign	0.00
R3610:Robo1	UTSW	16	72983770	missense	probably benign	0.00
R3940:Robo1	UTSW	16	73009743	missense	probably benign
R3953:Robo1	UTSW	16	73024338	missense	probably damaging	1.00
R4692:Robo1	UTSW	16	72960202	missense	probably damaging	1.00
R4726:Robo1	UTSW	16	72972043	missense	probably damaging	1.00
R4814:Robo1	UTSW	16	72972035	missense	probably benign	0.11
R4884:Robo1	UTSW	16	72904751	missense	probably damaging	1.00
R4992:Robo1	UTSW	16	72979868	missense	probably damaging	0.98
R5150:Robo1	UTSW	16	72972304	missense	possibly damaging	0.79
R5183:Robo1	UTSW	16	72742150	missense	probably benign	0.03
R5360:Robo1	UTSW	16	72935777	missense	probably damaging	0.96
R5629:Robo1	UTSW	16	72983710	missense	probably benign	0.33
R5804:Robo1	UTSW	16	73043189	critical splice donor site	probably null
R6107:Robo1	UTSW	16	72983829	missense	probably benign	0.00
R6127:Robo1	UTSW	16	73013068	missense	probably benign
R6128:Robo1	UTSW	16	73013068	missense	probably benign
R6129:Robo1	UTSW	16	73013068	missense	probably benign
R6191:Robo1	UTSW	16	72933808	missense	probably benign	0.00
R6357:Robo1	UTSW	16	72970302	missense	probably benign	0.00
R6408:Robo1	UTSW	16	72972046	missense	probably benign	0.00
R6516:Robo1	UTSW	16	73024353	missense	probably benign	0.14
R6600:Robo1	UTSW	16	72989655	missense	probably damaging	1.00
R6802:Robo1	UTSW	16	72933313	missense	probably benign	0.17
R7105:Robo1	UTSW	16	72742161	missense	probably damaging	1.00
R7189:Robo1	UTSW	16	72960151	nonsense	probably null
R7290:Robo1	UTSW	16	73004520	missense	probably benign	0.03
R7296:Robo1	UTSW	16	72989631	nonsense	probably null
R7576:Robo1	UTSW	16	72970181	missense	probably damaging	0.99
R7605:Robo1	UTSW	16	73024301	missense	probably benign	0.14
R7607:Robo1	UTSW	16	72563738	missense
R7634:Robo1	UTSW	16	73042978	splice site	probably null
R7636:Robo1	UTSW	16	72563727	missense
R7857:Robo1	UTSW	16	72970211	missense	probably damaging	1.00
R7966:Robo1	UTSW	16	72983872	missense	possibly damaging	0.62
R7997:Robo1	UTSW	16	72904693	missense	probably damaging	1.00
R8101:Robo1	UTSW	16	72978581	missense	probably benign	0.03
R8191:Robo1	UTSW	16	72933254	missense	probably damaging	1.00
R8218:Robo1	UTSW	16	72989790	missense	possibly damaging	0.91
R8228:Robo1	UTSW	16	73012880	missense	probably benign	0.30
R8292:Robo1	UTSW	16	72972532	missense	possibly damaging	0.61
R8298:Robo1	UTSW	16	72972132	intron	probably benign
R8332:Robo1	UTSW	16	72978578	missense	probably damaging	1.00
R8402:Robo1	UTSW	16	73024497	missense	probably benign	0.16
R8492:Robo1	UTSW	16	73013023	missense	probably benign	0.06
R8730:Robo1	UTSW	16	72989607	missense	probably benign	0.08
R8774:Robo1	UTSW	16	73035831	missense	probably benign	0.00
R8774-TAIL:Robo1	UTSW	16	73035831	missense	probably benign	0.00
R8776:Robo1	UTSW	16	73024253	nonsense	probably null
R8776-TAIL:Robo1	UTSW	16	73024253	nonsense	probably null
Z1176:Robo1	UTSW	16	72977800	missense	probably benign	0.16

Predicted Primers

PCR Primer
(F):5'- TGCAAAGGGATTGACAAGCCTCCG -3'
(R):5'- GTGCTTAGACAGGCATTTGCCCAG -3'

Sequencing Primer
(F):5'- TCGACGAGAAACTGCCCTG -3'
(R):5'- CATTTGCCCAGAGTGAGCTG -3'

Posted On

2013-05-09