Incidental Mutation 'R4606:Muc19'
ID 346042
Institutional Source Beutler Lab
Gene Symbol Muc19
Ensembl Gene ENSMUSG00000044021
Gene Name mucin 19
Synonyms apomucin, sld
MMRRC Submission 041817-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.130) question?
Stock # R4606 (G1)
Quality Score 225
Status Validated
Chromosome 15
Chromosomal Location 91838326-91934555 bp(+) (GRCm38)
Type of Mutation exon
DNA Base Change (assembly) C to T at 91934383 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s):
AlphaFold no structure available at present
Predicted Effect noncoding transcript
Transcript: ENSMUST00000088547
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160242
SMART Domains Protein: ENSMUSP00000125205
Gene: ENSMUSG00000044021

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
low complexity region 21 34 N/A INTRINSIC
VWD 47 198 1.31e-13 SMART
Pfam:C8 221 293 1.1e-8 PFAM
Pfam:TIL 298 353 1.6e-11 PFAM
VWD 383 545 1.58e-25 SMART
C8 577 651 8.71e-20 SMART
Pfam:TIL 654 711 2.1e-7 PFAM
Pfam:TIL 753 813 5.2e-8 PFAM
VWD 842 1005 2.36e-47 SMART
C8 1041 1115 1.84e-27 SMART
low complexity region 1220 1254 N/A INTRINSIC
Meta Mutation Damage Score 0.0869 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.0%
Validation Efficiency 96% (69/72)
MGI Phenotype PHENOTYPE: Mice homozygous for this spontaneous mutation show a partially arrested mucous cell differentiation of the sublingual glands. Severe inflammatory lesions resembling Sjogren's syndrome develop spontaneously in salivary and lacrimal glands of neonatally thymectomized mutants without any immunization. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700011L22Rik A T 8: 79,210,745 W178R probably benign Het
Abcb5 T C 12: 118,932,610 probably null Het
Akr1b3 C A 6: 34,306,664 probably benign Het
Arid1a A G 4: 133,687,323 F1199S unknown Het
Atp4b A G 8: 13,389,998 F116S probably damaging Het
Atp6v1b1 T C 6: 83,752,461 S127P probably damaging Het
Blk C T 14: 63,374,203 V428I probably benign Het
C87414 A T 5: 93,636,602 D137E probably damaging Het
Ccser1 T C 6: 61,311,584 S244P probably damaging Het
Ceacam1 T A 7: 25,474,526 I235F probably damaging Het
Cyp2g1 T A 7: 26,814,154 Y173N possibly damaging Het
Ddr2 T A 1: 170,001,852 I278F probably benign Het
Degs1 T C 1: 182,276,823 D299G probably damaging Het
Dip2b G A 15: 100,215,329 V1542I possibly damaging Het
Dmxl1 T A 18: 49,962,181 S2942R probably damaging Het
Dpf1 T A 7: 29,316,590 probably benign Het
Ephb6 A G 6: 41,616,574 Y518C probably benign Het
Eps15l1 A T 8: 72,373,916 F606I possibly damaging Het
Extl1 A G 4: 134,371,379 S114P probably damaging Het
Extl1 A C 4: 134,371,380 D113E probably benign Het
Fat1 T C 8: 44,950,683 V157A possibly damaging Het
Fcho1 A T 8: 71,712,480 D444E probably benign Het
Fgd3 T A 13: 49,296,560 D71V probably damaging Het
Fgd5 T A 6: 91,988,209 D316E possibly damaging Het
Gys2 A T 6: 142,454,484 F334I possibly damaging Het
Ik G T 18: 36,753,555 R360L possibly damaging Het
Kazn A C 4: 142,118,288 probably null Het
Kmt2d A T 15: 98,839,716 probably benign Het
Krr1 T C 10: 111,975,677 probably benign Het
Krt83 C T 15: 101,487,049 E389K probably benign Het
Lrrc4c T C 2: 97,630,313 V428A probably benign Het
Lvrn C A 18: 46,864,765 T260K possibly damaging Het
Mcc C T 18: 44,468,421 E614K probably damaging Het
Msrb3 A T 10: 120,849,997 V81D probably damaging Het
Myadm T A 7: 3,297,400 L226* probably null Het
Myof C T 19: 37,967,099 V526M probably damaging Het
Nckap5l A G 15: 99,429,323 probably benign Het
Olfr1010 T A 2: 85,753,940 probably benign Het
Olfr1260 C A 2: 89,978,006 A76D possibly damaging Het
Olfr1270 G T 2: 90,148,816 probably benign Het
Olfr398 A G 11: 73,983,892 S239P probably damaging Het
Pars2 T C 4: 106,654,050 V307A probably benign Het
Pcdhb1 T G 18: 37,265,528 Y177* probably null Het
Pcdhb4 T A 18: 37,308,652 D338E probably damaging Het
Pik3r2 G A 8: 70,772,136 R199* probably null Het
Pla2g4f C T 2: 120,313,986 R24Q probably benign Het
Pnma2 T C 14: 66,916,232 I35T probably benign Het
Podn C A 4: 108,017,867 A568S probably benign Het
Pou3f1 A T 4: 124,658,836 E377V probably damaging Het
Ppfia1 T C 7: 144,485,192 D494G probably damaging Het
Ptpn9 A T 9: 57,022,211 T71S possibly damaging Het
Ptprz1 C T 6: 23,001,487 P1192L possibly damaging Het
Rnd2 C T 11: 101,468,999 L57F probably damaging Het
Rnf217 T A 10: 31,517,476 K370* probably null Het
Rpap2 G A 5: 107,601,795 V62I possibly damaging Het
Scaper A T 9: 55,655,903 probably null Het
Sos2 T C 12: 69,614,606 probably benign Het
Sptbn5 C T 2: 120,067,446 probably null Het
Sumo1 A G 1: 59,644,509 probably benign Het
Syne2 C A 12: 75,989,253 N3771K probably damaging Het
Tbx18 T C 9: 87,730,769 I26V possibly damaging Het
Trpm3 T A 19: 22,978,624 M1140K probably benign Het
Usp29 G A 7: 6,963,357 probably null Het
Wdr7 C T 18: 63,779,945 Q946* probably null Het
Ythdf1 T C 2: 180,912,182 D46G probably damaging Het
Zfp217 T C 2: 170,119,750 N219S possibly damaging Het
Zkscan3 A G 13: 21,393,783 I256T probably benign Het
Other mutations in Muc19
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00985:Muc19 APN 15 91886749 exon noncoding transcript
IGL01017:Muc19 APN 15 91880707 exon noncoding transcript
IGL01140:Muc19 APN 15 91899399 exon noncoding transcript
IGL01292:Muc19 APN 15 91894276 exon noncoding transcript
IGL01397:Muc19 APN 15 91894304 exon noncoding transcript
IGL01525:Muc19 APN 15 91886683 exon noncoding transcript
IGL01589:Muc19 APN 15 91870501 exon noncoding transcript
IGL02023:Muc19 APN 15 91888259 exon noncoding transcript
IGL02088:Muc19 APN 15 91891168 splice site noncoding transcript
IGL02168:Muc19 APN 15 91894098 exon noncoding transcript
IGL02343:Muc19 APN 15 91894234 exon noncoding transcript
IGL02402:Muc19 APN 15 91893998 splice site noncoding transcript
IGL02433:Muc19 APN 15 91872496 exon noncoding transcript
IGL02533:Muc19 APN 15 91898047 exon noncoding transcript
IGL02558:Muc19 APN 15 91897622 exon noncoding transcript
IGL02652:Muc19 APN 15 91877815 critical splice donor site noncoding transcript
IGL03032:Muc19 APN 15 91910539 unclassified noncoding transcript
IGL02837:Muc19 UTSW 15 91882656 exon noncoding transcript
R0098:Muc19 UTSW 15 91892907 exon noncoding transcript
R0098:Muc19 UTSW 15 91892907 exon noncoding transcript
R0208:Muc19 UTSW 15 91893024 splice site noncoding transcript
R0597:Muc19 UTSW 15 91900502 splice site noncoding transcript
R1185:Muc19 UTSW 15 91878549 exon noncoding transcript
R1185:Muc19 UTSW 15 91878549 exon noncoding transcript
R1469:Muc19 UTSW 15 91874300 unclassified noncoding transcript
R1942:Muc19 UTSW 15 91892472 exon noncoding transcript
R2035:Muc19 UTSW 15 91892405 splice site noncoding transcript
R2208:Muc19 UTSW 15 91871549 exon noncoding transcript
R2877:Muc19 UTSW 15 91893006 exon noncoding transcript
R2897:Muc19 UTSW 15 91924665 critical splice donor site noncoding transcript
R4110:Muc19 UTSW 15 91897622 exon noncoding transcript
R4403:Muc19 UTSW 15 91871570 exon noncoding transcript
R4677:Muc19 UTSW 15 91888217 exon noncoding transcript
R4753:Muc19 UTSW 15 91877761 unclassified noncoding transcript
R4781:Muc19 UTSW 15 91903166 critical splice donor site noncoding transcript
R4869:Muc19 UTSW 15 91897716 exon noncoding transcript
R5000:Muc19 UTSW 15 91873231 unclassified noncoding transcript
R5044:Muc19 UTSW 15 91888138 exon noncoding transcript
R5156:Muc19 UTSW 15 91900420 exon noncoding transcript
R5176:Muc19 UTSW 15 91892180 exon noncoding transcript
R5224:Muc19 UTSW 15 91928025 exon noncoding transcript
R5524:Muc19 UTSW 15 91894393 exon noncoding transcript
R5568:Muc19 UTSW 15 91884274 splice site noncoding transcript
R5592:Muc19 UTSW 15 91930314 exon noncoding transcript
Predicted Primers PCR Primer
(F):5'- TTGAAGCGTTTCTCACTGAATTCC -3'
(R):5'- ATCCACGTCTTCACCAAGTC -3'

Sequencing Primer
(F):5'- TCACTGAATTCCTTTCTTTTAGGTAC -3'
(R):5'- AAGTCCTTGCACCATGGC -3'
Posted On 2015-09-25